Rat Cav3 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_019155.2)
Pre-made Rat Cav3/ Adeno-associated virus expression plasmid (ITR-vector) for Cav3 AAV packaging, Cav3 AAV production.The purified Rat Cav3/ AAV particle serves as an invaluable asset for in-depth in vivo Cav3 studies, mechanism of action (MOA) research, and the evolution of Cav3-associated gene therapy strategies.
Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.
Go
to CAV3/Cav3/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAAV000507 | Rat Cav3 Adeno-associate virus(AAV) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAAV000507 |
Gene Name | Cav3 |
Accession Number | NM_019155.2 |
Gene ID | 29161 |
Species | Rat |
Product Type | Adeno-associate virus(AAV) plasmid (overexpression) |
Insert Length | 456 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGATGACCGAAGAGCACACAGATCTGGAGGCACGGATCATCAAGGACATTCACTGCAAGGAGATAGACTTGGTGAACAGAGACCCCAAGAACATCAATGAGGACATTGTGAAGGTGGATTTTGAAGATGTGATTGCGGAGCCCGAGGGCACTTACAGCTTCGATGGCGTGTGGAGGGTGAGCTACACCACTTTCACCGTCTCCAAGTACTGGTGCTACCGCCTGCTGTCTACACTGCTGGGTGTTCCACTGGCCCTGCTCTGGGGATTCCTGTTTGCCTGTATCTCCTTCTGCCACATCTGGGCCGTGGTGCCCTGCATTAAGAGCTACCTGATTGAGATCCAGTGCATCAGCCACATCTACTCACTGTGTATCCGCACCTTCTGCAACCCGCTCTTTGCCGCACTGGGCCAGGTCTGCAGCAACATTAAGGTGGTGCTGCGAAGGGAAGGCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0187-Ab | Anti-CAV3/ LGMD1C/ LQT9 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0187-Ag | CAV3 VLP (virus-like particle) |
ORF Viral Vector | pGMAD000634 | Rat Cav3 Adenovirus plasmid |
ORF Viral Vector | pGMAAV000277 | Rat Cav3 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV000425 | Human CAV3 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV000507 | Rat Cav3 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMPC000372 | Human CAV3 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP002892 | Human CAV3 Lentivirus plasmid |
ORF Viral Vector | vGMAD000634 | Rat Cav3 Adenovirus particle |
ORF Viral Vector | vGMAAV000277 | Rat Cav3 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV000425 | Human CAV3 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV000507 | Rat Cav3 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP002892 | Human CAV3 Lentivirus particle |
Target information
Target ID | GM-MP0187 |
Target Name | CAV3 |
Gene ID | 859, 12391, 702163, 29161, 101081453, 484671, 615310, 100058881 |
Gene Symbol and Synonyms | Cav-3,CAV3,LGMD1C,LQT9,M-cav,MPDT,RMD2,VIP-21,VIP21 |
Uniprot Accession | P56539 |
Uniprot Entry Name | CAV3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000182533 |
Target Classification | Not Available |
This gene encodes a caveolin family member, which functions as a component of the caveolae plasma membranes found in most cell types. Caveolin proteins are proposed to be scaffolding proteins for organizing and concentrating certain caveolin-interacting molecules. Mutations identified in this gene lead to interference with protein oligomerization or intra-cellular routing, disrupting caveolae formation and resulting in Limb-Girdle muscular dystrophy type-1C (LGMD-1C), hyperCKemia or rippling muscle disease (RMD). Alternative splicing has been identified for this locus, with inclusion or exclusion of a differentially spliced intron. In addition, transcripts utilize multiple polyA sites and contain two potential translation initiation sites. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.