- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Rat Txnip/Vdup1 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_001008767.1)
Pre-made Rat Txnip/Vdup1 Adeno-associated virus expression plasmid (ITR-vector) for Txnip AAV packaging, Txnip AAV production.The purified Rat Txnip/Vdup1 AAV particle serves as an invaluable asset for in-depth in vivo Txnip studies, mechanism of action (MOA) research, and the evolution of Txnip-associated gene therapy strategies.
Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.
Go
to VDUP1/Txnip/Vdup1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMAAV000569 | Rat Txnip Adeno-associate virus(AAV) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMAAV000569 |
| Gene Name | Txnip |
| Accession Number | NM_001008767.1 |
| Gene ID | 117514 |
| Species | Rat |
| Product Type | Adeno-associate virus(AAV) plasmid (overexpression) |
| Insert Length | 1185 bp |
| Gene Alias | Vdup1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGTGATGTTCAAGAAGATCAAGTCTTTTGAGGTGGTCTTCAACGACCCTGAGAAGGTGTATGGCAGCGGGGAGAAGGTGGCCGGCCGGGTGACAGTGGAAGTGTGTGAAGTTACCCGAGTCAAAGCCGTCAGGATCCTGGCTTGCGGTGTGGCCAAGGTCCTGTGGATGCAAGGGTCTCAGCAGTGCAAACAGACCTTGGACTACTTGCGCTATGAAGACACCCTTCTCCTAGAAGACCAGCCTACAGGTGAGAACGAGATGGTGATCATGAGACCAGGAAACAAATATGAGTACAAGTTCGGCTTTGAGCTTCCTCAAGGGCCCCTGGGAACATCCTTCAAAGGGAAATATGGCTGTGTAGACTACTGGGTGAAGGCTTTTCTCGATCGTCCCAGCCAGCCAACTCAAGAGGCAAAGAAAAACTTTGAAGTGATGGATCTAGTGGACGTCAATACTCCTGACTTAATGGCACCAGTGTCTGCCAAAAAGGAGAAGAAAGTTTCCTGCATGTTCATTCCTGATGGACGCGTGTCAGTCTCCGCTCGAATCGACAGAAAAGGATTCTGTGAAGGTGATGACATTTCCATCCACGCTGACTTTGAGAACACATGTTCCCGAATCGTGGTCCCCAAAGCAGCTATTGTGGCCCGGCACACTTACCTTGCCAATGGCCAGACCAAAGTGCTCACTCAGAAGCTGTCCTCAGTCAGAGGCAATCACATTATCTCAGGGACTTGCGCATCATGGCGTGGCAAGAGTCTCCGAGTGCAGAAGATCAGACCGTCCATTCTGGGCTGCAACATCCTCAGAGTTGAATACTCCTTGCTGATCTATGTTAGTGTCCCTGGCTCCAAGAAAGTCATCCTCGATCTGCCCCTAGTGATTGGCAGCAGGTCGGGCCTAAGCAGCCGGACATCCAGCATGGCTAGCCGGACAAGCTCTGAAATGAGCTGGATAGACCTAAACATCCCAGACACCCCAGAAGCTCCACCTTGCTATATGGACGTGATTCCTGAAGATCACAGACTGGAGAGCCCCACCACCCCCCTGCTAGATGATGTGGATGATTCTCAAGACAGCCCTATCTTTATGTACGCCCCCGAGTTCCAGTTCATGCCTCCGCCCACTTACACTGAGGTGGATCCCTGCGTCCTTAACAACAACAACAACAACGTGCAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP0163-Ab | Anti-VDUP1 monoclonal antibody |
| Target Antigen | GM-Tg-g-IP0163-Ag | VDUP1/TXNIP protein |
| ORF Viral Vector | pGMLV000188 | Human TXNIP Lentivirus plasmid |
| ORF Viral Vector | pGMLV001158 | Human TXNIP Lentivirus plasmid |
| ORF Viral Vector | pGMAAV000569 | Rat Txnip Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMAAV000593 | Rat Txnip Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMPC000243 | Human TXNIP Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC001146 | Human TXNIP Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMAP000591 | Human TXNIP Adenovirus plasmid |
| ORF Viral Vector | vGMLV000188 | Human TXNIP Lentivirus particle |
| ORF Viral Vector | vGMLV001158 | Human TXNIP Lentivirus particle |
| ORF Viral Vector | vGMAAV000569 | Rat Txnip Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMAAV000593 | Rat Txnip Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMAP000591 | Human TXNIP Adenovirus particle |
Target information
| Target ID | GM-IP0163 |
| Target Name | VDUP1 |
| Gene ID | 10628, 56338, 698683, 117514, 101099739, 475829, 506790, 111773538 |
| Gene Symbol and Synonyms | 1200008J08Rik,ARRDC6,EST01027,HHCPA78,Hyplip1,Tbp-2,THIF,TXNIP,VDUP1 |
| Uniprot Accession | Q9H3M7 |
| Uniprot Entry Name | TXNIP_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000265972 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a thioredoxin-binding protein that is a member of the alpha arrestin protein family. Thioredoxin is a thiol-oxidoreductase that is a major regulator of cellular redox signaling which protects cells from oxidative stress. This protein inhibits the antioxidative function of thioredoxin resulting in the accumulation of reactive oxygen species and cellular stress. This protein also functions as a regulator of cellular metabolism and of endoplasmic reticulum (ER) stress. This protein may also function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
