Rat Pten/Mmac/ MMAC1 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_031606)
Pre-made Rat Pten/Mmac/ MMAC1 Adeno-associated virus expression plasmid (ITR-vector) for Pten AAV packaging, Pten AAV production.The purified Rat Pten/Mmac/ MMAC1 AAV particle serves as an invaluable asset for in-depth in vivo Pten studies, mechanism of action (MOA) research, and the evolution of Pten-associated gene therapy strategies.
Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.
Go
to PTEN/Pten/Mmac products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAAV000737 | Rat Pten Adeno-associate virus(AAV) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAAV000737 |
Gene Name | Pten |
Accession Number | NM_031606 |
Gene ID | 50557 |
Species | Rat |
Product Type | Adeno-associate virus(AAV) plasmid (overexpression) |
Insert Length | 1212 bp |
Gene Alias | Mmac, MMAC1, TEP1 |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAGGATGGATTCGACTTAGACTTGACCTATATTTATCCAAATATTATTGCTATGGGATTTCCTGCAGAAAGACTTGAAGGTGTATACAGGAACAATATTGATGATGTAGTAAGGTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTATGTGCTGAGAGACATTATGACACCGCCAAATTTAACTGCAGAGTTGCACAGTATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGACGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGGAAAGGACGGACTGGTGTAATGATTTGTGCATATTTATTGCATCGGGGCAAGTTTTTAAAGGCACAAGAGGCCCTGGATTTTTATGGGGAAGTAAGGACCAGAGATAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTATATTATTATAGCTACCTGTTAAAGAATCACCTGGATTACAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCCCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATCTACTCCTCCAACTCAGGACCCACGCGGCGGGAGGACAAGCTCATGTACTTTGAGTTCCCTCAGCCATTGCCTGTGTGTGGTGACATCAAAGTAGAGTTCTTCCACAAACAGAACAAGATGCTCAAAAAGGACAAAATGTTTCACTTTTGGGTAAATACGTTCTTCATACCAGGACCAGAGGAAACCTCAGAAAAAGTGGAAAATGGAAGTCTTTGTGATCAGGAAATCGATAGCATTTGTAGTATAGAGCGTGCGGATAATGACAAGGAGTATCTTGTGCTCACCCTGACAAAAAATGATCTTGACAAAGCAAACAAAGACAAGGCCAACCGATACTTCTCTCCAAATTTTAAGGTGAAGTTATACTTCACAAAAACAGTAGAGGAGCCATCAAATCCAGAGGCTAGCAGTTCAACTTCTGTGACTCCAGACGTTAGTGACAATGAACCTGATCATTATAGATATTCTGACACCACTGACTCTGATCCAGAGAATGAACCTTTTGATGAAGATCAGCATTCACAAATTACAAAAGTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T38257 |
Target Name | PTEN |
Gene ID | 5728, 19211, 705121, 50557, 101091813, 403832, 540786, 100062388 |
Gene Symbol and Synonyms | 10q23del,2310035O07Rik,A130070J02Rik,B430203M17Rik,BZS,CWS1,DEC,GLM2,MHAM,Mmac,MMAC1,PTEN,PTEN1,PTENbeta,TEP1 |
Uniprot Accession | P60484 |
Uniprot Entry Name | PTEN_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000171862 |
Target Classification | Tumor-associated antigen (TAA) |
This gene was identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. The protein encoded by this gene is a phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase. It contains a tensin like domain as well as a catalytic domain similar to that of the dual specificity protein tyrosine phosphatases. Unlike most of the protein tyrosine phosphatases, this protein preferentially dephosphorylates phosphoinositide substrates. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway. The use of a non-canonical (CUG) upstream initiation site produces a longer isoform that initiates translation with a leucine, and is thought to be preferentially associated with the mitochondrial inner membrane. This longer isoform may help regulate energy metabolism in the mitochondria. A pseudogene of this gene is found on chromosome 9. Alternative splicing and the use of multiple translation start codons results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.