- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Rat Atf4 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_024403.2)
Pre-made Rat Atf4/ Adeno-associated virus expression plasmid (ITR-vector) for Atf4 AAV packaging, Atf4 AAV production.The purified Rat Atf4/ AAV particle serves as an invaluable asset for in-depth in vivo Atf4 studies, mechanism of action (MOA) research, and the evolution of Atf4-associated gene therapy strategies.
Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.
Go
to ATF-4/Atf4/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMAAV000923 | Rat Atf4 Adeno-associate virus(AAV) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMAAV000923 |
| Gene Name | Atf4 |
| Accession Number | NM_024403.2 |
| Gene ID | 79255 |
| Species | Rat |
| Product Type | Adeno-associate virus(AAV) plasmid (overexpression) |
| Insert Length | 1044 bp |
| Gene Alias | |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGACCGAGATGAGCTTCCTGAACAGCGAAGTGTTGGCGGGGGACTTAATGTCCCCCTTCGACCAGTCGGGTTTGGGGGCTGAAGAAAGCCTAGGTCTCTTAGATGACTATCTGGAGGTGGCCAAGCACTTCAAACCTCATGGGTTCTCCAGCGACAAGGCGGGCTCCTCAGAATGGCTGGCTATGGATGGGTTGGTCAGTGCCTCAGACACCGGCAAGGAGGATGCCTTTTCCGGGACAGATTGGATGTTGGAGAAAATGGACCTGAAAGAGTTTGACTTCGATGCTCTGTTTCGAATGGATGACCTGGAAACCATGCCAGATGAGCTTTTGGCCACGTTGGATGACACATGTGATCTTTTTGCCCCTCTAGTCCAAGAGACTAATAAGGAGCCCCCTCAGACAGTGAACCCAATTGGCCATCTCCCAGAAAGTGTAATAAAAGTCGACCAGGCTGCCCCCTTTACATTCTTGCAGCCTCTTCCCTGTTCCCCAGGGTTTCTGTCTTCCACTCCAGATCATTCCTTTAGTTTAGAGCTGGGAAGTGAGGTTGATATCTCTGAAGGAGATAGGAAGCCTGACTCTGCTGCTTATATTACTCTAACCCCTCAGTGTGTAAAGGAGGAAGACACTCCCTCTGATAGTGACAGTGGCATCTGTATGAGCCCTGAGTCCTACCTGGGCTCTCCCCAACACAGCCCTTCCACCTCCAGGGCCCCACCAGACAGTCTGCCTTCTCCAGGTGTTCCTCGTGGTTCTCGACCCAAACCTTATGACCCACCTGGAGTTAGTGTGACAGCTAAAGTGAAGACTGAAAAGTTGGATAAGAAGCTGAAAAAGATGGAGCAAAACAAGACAGCAGCTACTAGGTACCGCCAGAAGAAGAGGGCTGAGCAGGAAGCCCTCACTGGCGAGTGTAAAGAGCTAGAAAAGAAGAACGAGGCTCTGAAAGAGAAGGCAGATTCTCTCGCCAAAGAGATTCAGTATCTAAAAGACCTGATAGAAGAGGTCCGTAAGGCAAGGGGGAAGAAGAGAGTTCCTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T53270-Ab | Anti-ATF-4 monoclonal antibody |
| Target Antigen | GM-Tg-g-T53270-Ag | ATF-4/ATF4 protein |
| ORF Viral Vector | pGMLV000321 | Human ATF4 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000496 | Human ATF4 Lentivirus plasmid |
| ORF Viral Vector | pGMAAV000923 | Rat Atf4 Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMPC000693 | Human ATF4 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLV000321 | Human ATF4 Lentivirus particle |
| ORF Viral Vector | vGMLV000496 | Human ATF4 Lentivirus particle |
| ORF Viral Vector | vGMAAV000923 | Rat Atf4 Adeno-associate virus(AAV) particle |
Target information
| Target ID | GM-T53270 |
| Target Name | ATF-4 |
| Gene ID | 468, 11911, 703965, 79255, 101084297, 474503, 509107, 100070334 |
| Gene Symbol and Synonyms | Atf-4,ATF4,C/ATF,CREB-2,CREB2,TAXREB67,TXREB |
| Uniprot Accession | P18848 |
| Uniprot Entry Name | ATF4_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000128272 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a transcription factor that was originally identified as a widely expressed mammalian DNA binding protein that could bind a tax-responsive enhancer element in the LTR of HTLV-1. The encoded protein was also isolated and characterized as the cAMP-response element binding protein 2 (CREB-2). The protein encoded by this gene belongs to a family of DNA-binding proteins that includes the AP-1 family of transcription factors, cAMP-response element binding proteins (CREBs) and CREB-like proteins. These transcription factors share a leucine zipper region that is involved in protein-protein interactions, located C-terminal to a stretch of basic amino acids that functions as a DNA binding domain. Two alternative transcripts encoding the same protein have been described. Two pseudogenes are located on the X chromosome at q28 in a region containing a large inverted duplication. [provided by RefSeq, Sep 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
