Rat Ccn1/Cyr61 ORF/cDNA clone-Adenovirus plasmid (NM_031327.2)

Pre-made Rat Ccn1/Cyr61 adenoviral expression plasmid for Ccn1 adenovirus packaging, Ccn1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to CCN1/Ccn1/Cyr61 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAD000547 Rat Ccn1 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAD000547
Gene Name Ccn1
Accession Number NM_031327.2
Gene ID 83476
Species Rat
Product Type Adenovirus plasmid (overexpression)
Insert Length 1140 bp
Gene Alias Cyr61
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCTCCAGCACCATCAAGACGCTCGCTGTCGCCGTCACCCTTCTCCACTTGACCAGGCTGGCACTCTCCACCTGCCCTGCCGCCTGCCACTGCCCTCTGGAGGCGCCCAAGTGCGCCCCGGGAGTCGGCTTGGTCCGGGACGGCTGCGGCTGCTGTAAGGTCTGCGCGAAGCAACTCAACGAGGACTGCAGCAAAACGCAGCCCTGCGACCACACCAAGGGGCTGGAATGCAATTTCGGCGCCAGTTCCACCGCTCTGAAAGGGATCTGCAGAGCTCAGTCAGAAGGCAGACCCTGTGAATATAACTCCAGGATCTACCAGAACGGGGAGAGCTTCCAACCCAACTGTAAACATCAGTGCACATGTATTGACGGTGCTGTGGGCTGCATTCCTCTGTGTCCCCAAGAACTGTCTCTCCCCAATCTGGGCTGTCCCAACCCCCGGCTGGTGAAAGTCAGCGGGCAGTGCTGTGAGGAATGGGTCTGTGATGAAGACAGCATTAAGGACTCCCTGGACGACCAGGACGACCTCCTTGGATTCGATGCCTCGGAGGTGGAGTTAACAAGAAACAATGAGTTAATCGCAATTGGCAAAGGCAGCTCACTGAAGAGGCTTCCTGTCTTTGGCACGGAACCTCGAGTCCTTTACAACCCCCTGCATGCCCATGGCCAGAAATGCATCGTTCAGACTACGTCCTGGTCCCAGTGCTCCAAGAGCTGCGGAACTGGCATCTCCACACGAGTTACCAATGACAACTCGGAGTGCCGCCTGGTGAAAGAGACCCGGATCTGTGAAGTGCGTCCTTGTGGACAACCAGTGTACAGCAGCCTAAAAAAGGGCAAGAAATGCAGCAAGACCAAGAAATCCCCAGAACCAGTCCGATTTACTTATGCAGGATGCTCCAGTGTGAAGAAATACCGGCCCAAATACTGCGGCTCCTGCGTGGACGGCCGGTGCTGCACACCTCTGCAGACCAGGACCGTGAAGATGCGGTTCCGGTGCGAAGATGGCGAGATGTTCTCCAAGAACGTCATGATGATTCAGTCCTGCAAGTGTAACTACAACTGCCCGCATCCCAACGAGGCGTCGTTTCGCCTCTACAGTCTGTTCAACGATATCCACAAGTTCAGGGACTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T56505-Ab Anti-CCN1/ CYR61/ GIG1 functional antibody
    Target Antigen GM-Tg-g-T56505-Ag CCN1 protein
    ORF Viral Vector pGMAD000547 Rat Ccn1 Adenovirus plasmid
    ORF Viral Vector pGMPC001073 Rat Ccn1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000491 Human CCN1 Lentivirus plasmid
    ORF Viral Vector pGMAP000008 Human CCN1 Adenovirus plasmid
    ORF Viral Vector vGMAD000547 Rat Ccn1 Adenovirus particle
    ORF Viral Vector vGMLP000491 Human CCN1 Lentivirus particle
    ORF Viral Vector vGMAP000008 Human CCN1 Adenovirus particle


    Target information

    Target ID GM-T56505
    Target Name CCN1
    Gene ID 3491, 16007, 714970, 83476, 101100068, 479967, 508941, 100064066
    Gene Symbol and Synonyms CCN1,CYR61,GIG1,IGFBP10
    Uniprot Accession O00622
    Uniprot Entry Name CCN1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000142871
    Target Classification Tumor-associated antigen (TAA)

    The secreted protein encoded by this gene is growth factor-inducible and promotes the adhesion of endothelial cells. The encoded protein interacts with several integrins and with heparan sulfate proteoglycan. This protein also plays a role in cell proliferation, differentiation, angiogenesis, apoptosis, and extracellular matrix formation. [provided by RefSeq, Sep 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.