Rat Hdac1 ORF/cDNA clone-Adenovirus plasmid (NM_001025409.1)

Pre-made Rat Hdac1/ adenoviral expression plasmid for Hdac1 adenovirus packaging, Hdac1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to HDAC1/Hdac1/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAD000603 Rat Hdac1 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAD000603
Gene Name Hdac1
Accession Number NM_001025409.1
Gene ID 297893
Species Rat
Product Type Adenovirus plasmid (overexpression)
Insert Length 1449 bp
Gene Alias
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGCAGACTCAGGGCACCAAGAGGAAAGTCTGTTACTACTACGACGGGGATGTTGGAAACTACTATTATGGACAAGGGCACCCAATGAAGCCTCACCGAATCCGAATGACTCATAATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGTCCTCACAAAGCCAACGCTGAGGAGATGACCAAGTACCACAGCGACGACTACATCAAGTTCTTGCGTTCTATTCGCCCAGACAATATGTCTGAATACAGCAAGCAGATGCAGAGATTCAACGTGGGTGAGGACTGTCCGGTATTTGATGGCTTGTTTGAGTTCTGTCAGTTGTCCACGGGTGGCTCTGTCGCGAGTGCTGTGAAACTCAATAAGCAGCAGACGGACATCGCTGTGAACTGGGCTGGGGGCCTGCACCATGCGAAGAAGTCTGAAGCATCCGGCTTCTGTTACGTCAATGATATTGTCTTGGCCATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTATATTGACATTGACATTCACCATGGCGATGGCGTGGAAGAGGCCTTCTATACCACAGACCGGGTCATGACTGTGTCCTTTCATAAATACGGAGAGTACTTCCCAGGAACTGGGGACCTACGGGATATTGGGGCTGGCAAAGGCAAGTACTACGCCGTTAACTACCCACTGCGAGATGGCATTGATGATGAGTCCTATGAAGCCATCTTTAAGCCAGTCATGTCCAAAGTAATGGAGATGTTCCAGCCTAGTGCAGTGGTCCTACAGTGCGGCTCAGACTCCCTGTCTGGGGATCGGCTAGGTTGCTTCAATCTGACCATCAAAGGACATGCCAAGTGTGTGGAGTTCGTGAAGAGTTTCAACTTGCCGATGCTAATGTTGGGAGGAGGTGGCTATACCATCCGTAATGTCGCTCGGTGCTGGACTTACGAGACAGCTGTGGCCCTGGACACAGAGATCCCTAATGAGCTACCATACAATGACTACTTTGAATACTTTGGACCAGATTTCAAGCTTCACATCAGCCCTTCCAATATGACTAACCAGAACACTAATGAATACCTGGAGAAGATCAAGCAGCGGCTCTTTGAGAACTTGAGAATGCTGCCCCATGCCCCTGGGGTCCAAATGCAGGCCATCCCAGAGGATGCCATCCCAGAAGAGAGCGGTGATGAGGATGAGGAAGACCCTGACAAACGAATTTCCATCTGCTCCTCTGACAAACGCATTGCCTGTGAGGAGGAATTCTCTGATTCTGATGAGGAGGGAGAAGGAGGTCGCAAGAACTCTTCTAACTTCAAAAAAGCCAAAAGAGTCAAAACAGAAGATGAAAAAGAAAAAGATCCCGAGGAGAAAAAAGAAGTCACAGAAGAGGAGAAAACCAAGGAGGAGAAGCCAGAAGCCAAAGGGGTCAAAGAAGAGGTCAAGATGGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T68547-Ab Anti-HDAC1 monoclonal antibody
    Target Antigen GM-Tg-g-T68547-Ag HDAC1 protein
    ORF Viral Vector pGMAD000603 Rat Hdac1 Adenovirus plasmid
    ORF Viral Vector pGMLP000625 Human HDAC1 Lentivirus plasmid
    ORF Viral Vector vGMAD000603 Rat Hdac1 Adenovirus particle
    ORF Viral Vector vGMLP000625 Human HDAC1 Lentivirus particle
    ORF Viral Vector pGMLV002501 Human HDAC1 Lentivirus plasmid


    Target information

    Target ID GM-T68547
    Target Name HDAC1
    Gene ID 3065, 433759, 708441, 297893, 101099228, 487309, 404126, 100070281
    Gene Symbol and Synonyms GON-10,HD1,HDAC1,Hdac1-ps,KDAC1,MommeD5,RPD3,RPD3L1
    Uniprot Accession Q13547
    Uniprot Entry Name HDAC1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000116478
    Target Classification Tumor-associated antigen (TAA)

    Histone acetylation and deacetylation, catalyzed by multisubunit complexes, play a key role in the regulation of eukaryotic gene expression. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family and is a component of the histone deacetylase complex. It also interacts with retinoblastoma tumor-suppressor protein and this complex is a key element in the control of cell proliferation and differentiation. Together with metastasis-associated protein-2, it deacetylates p53 and modulates its effect on cell growth and apoptosis. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.