Rat Igf1/IGF ORF/cDNA clone-Adenovirus plasmid (NM_001082479.1)

Pre-made Rat Igf1/IGF adenoviral expression plasmid for Igf1 adenovirus packaging, Igf1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to IGF1/Igf1/IGF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAD000636 Rat Igf1 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAD000636
Gene Name Igf1
Accession Number NM_001082479.1
Gene ID 24482
Species Rat
Product Type Adenovirus plasmid (overexpression)
Insert Length 462 bp
Gene Alias IGF
Fluorescent Reporter
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGAAAATCAGCAGTCTTCCAACTCAATTATTTAAGATCTGCCTCTGTGACTTCTTGAAGATAAAGATACACATCATGTCGTCTTCACATCTCTTCTACCTGGCACTCTGCTTGCTCACCTTTACCAGCTCGGCCACAGCCGGACCAGAGACCCTTTGCGGGGCTGAGCTGGTGGACGCTCTTCAGTTCGTGTGTGGACCAAGGGGCTTTTACTTCAACAAGCCCACAGGCTATGGCTCCAGCATTCGGAGGGCACCACAGACGGGCATTGTGGATGAGTGTTGCTTCCGGAGCTGTGATCTGAGGAGGCTGGAGATGTACTGTGCTCCGCTGAAGCCTACAAAGTCAGCTCGTTCCATCCGGGCCCAGCGCCACACTGACATGCCCAAGACTCAGAAGGAAGTACACTTGAAGAACACAAGTAGAGGAAGTGCAGGAAACAAGACCTACAGAATGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-634 Pre-Made Xentuzumab biosimilar, Whole mAb, Anti-IGF1;IGF2 Antibody: Anti-IGF/IGF-I/IGFI/MGF;C11orf43/GRDF/IGF-II/PP9974/SRS3 therapeutic antibody
    Biosimilar GMP-Bios-ab-160 Pre-Made Dusigitumab biosimilar, Whole mAb, Anti-IGF1;IGF2 Antibody: Anti-IGF/IGF-I/IGFI/MGF;C11orf43/GRDF/IGF-II/PP9974/SRS3 therapeutic antibody
    Target Antibody GM-Tg-g-T60930-Ab Anti-IGF1/ IGF/ IGF-I functional antibody
    Target Antigen GM-Tg-g-T60930-Ag IGF1 protein
    Cytokine cks-Tg-g-GM-T60930 insulin-like growth factor 1 (IGF1) protein & antibody
    ORF Viral Vector pGMAD000636 Rat Igf1 Adenovirus plasmid
    ORF Viral Vector vGMAD000636 Rat Igf1 Adenovirus particle


    Target information

    Target ID GM-T60930
    Target Name IGF1
    Gene ID 3479, 16000, 698444, 24482, 101101237, 610255, 281239, 100034198
    Gene Symbol and Synonyms C730016P09Rik,IGF,Igf-1,IGF-I,IGF1,IGFI,IGFIA,MGF
    Uniprot Accession P05019
    Uniprot Entry Name IGF1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000017427
    Target Classification Not Available

    The protein encoded by this gene is similar to insulin in function and structure and is a member of a family of proteins involved in mediating growth and development. The encoded protein is processed from a precursor, bound by a specific receptor, and secreted. Defects in this gene are a cause of insulin-like growth factor I deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.