Rat Igf1/IGF ORF/cDNA clone-Adenovirus plasmid (NM_001082479.1)
Pre-made Rat Igf1/IGF adenoviral expression plasmid for Igf1 adenovirus packaging, Igf1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to IGF1/Igf1/IGF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAD000636 | Rat Igf1 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAD000636 |
Gene Name | Igf1 |
Accession Number | NM_001082479.1 |
Gene ID | 24482 |
Species | Rat |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 462 bp |
Gene Alias | IGF |
Fluorescent Reporter | |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGAAAATCAGCAGTCTTCCAACTCAATTATTTAAGATCTGCCTCTGTGACTTCTTGAAGATAAAGATACACATCATGTCGTCTTCACATCTCTTCTACCTGGCACTCTGCTTGCTCACCTTTACCAGCTCGGCCACAGCCGGACCAGAGACCCTTTGCGGGGCTGAGCTGGTGGACGCTCTTCAGTTCGTGTGTGGACCAAGGGGCTTTTACTTCAACAAGCCCACAGGCTATGGCTCCAGCATTCGGAGGGCACCACAGACGGGCATTGTGGATGAGTGTTGCTTCCGGAGCTGTGATCTGAGGAGGCTGGAGATGTACTGTGCTCCGCTGAAGCCTACAAAGTCAGCTCGTTCCATCCGGGCCCAGCGCCACACTGACATGCCCAAGACTCAGAAGGAAGTACACTTGAAGAACACAAGTAGAGGAAGTGCAGGAAACAAGACCTACAGAATGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-634 | Pre-Made Xentuzumab biosimilar, Whole mAb, Anti-IGF1;IGF2 Antibody: Anti-IGF/IGF-I/IGFI/MGF;C11orf43/GRDF/IGF-II/PP9974/SRS3 therapeutic antibody |
Biosimilar | GMP-Bios-ab-160 | Pre-Made Dusigitumab biosimilar, Whole mAb, Anti-IGF1;IGF2 Antibody: Anti-IGF/IGF-I/IGFI/MGF;C11orf43/GRDF/IGF-II/PP9974/SRS3 therapeutic antibody |
Target Antibody | GM-Tg-g-T60930-Ab | Anti-IGF1/ IGF/ IGF-I functional antibody |
Target Antigen | GM-Tg-g-T60930-Ag | IGF1 protein |
Cytokine | cks-Tg-g-GM-T60930 | insulin-like growth factor 1 (IGF1) protein & antibody |
ORF Viral Vector | pGMAD000636 | Rat Igf1 Adenovirus plasmid |
ORF Viral Vector | vGMAD000636 | Rat Igf1 Adenovirus particle |
Target information
Target ID | GM-T60930 |
Target Name | IGF1 |
Gene ID | 3479, 16000, 698444, 24482, 101101237, 610255, 281239, 100034198 |
Gene Symbol and Synonyms | C730016P09Rik,IGF,Igf-1,IGF-I,IGF1,IGFI,IGFIA,MGF |
Uniprot Accession | P05019 |
Uniprot Entry Name | IGF1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000017427 |
Target Classification | Not Available |
The protein encoded by this gene is similar to insulin in function and structure and is a member of a family of proteins involved in mediating growth and development. The encoded protein is processed from a precursor, bound by a specific receptor, and secreted. Defects in this gene are a cause of insulin-like growth factor I deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.