Rat Tlr4 ORF/cDNA clone-Adenovirus plasmid (NM_019178.1)

Pre-made Rat Tlr4/ adenoviral expression plasmid for Tlr4 adenovirus packaging, Tlr4 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to TLR4/Tlr4/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAD000929 Rat Tlr4 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAD000929
Gene Name Tlr4
Accession Number NM_019178.1
Gene ID 29260
Species Rat
Product Type Adenovirus plasmid (overexpression)
Insert Length 2508 bp
Gene Alias
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATGCCTCTCTTGCATCTGGCTGGGACTCTGATCATGGCATTGTTCCTTTCCTGCCTGAGACCAGGAAGCTTGAATCCCTGCATAGAGGTACTTCCTAATATTACCTACCAATGCATGGATCAGAATCTCAGCAAAATCCCTCATGACATCCCTTATTCAACCAAGAACCTAGATCTGAGCTTCAACCCCCTGAAGATCTTAAGAAGCTATAGCTTCACCAATTTCTCACAACTTCAGTGGCTGGATTTATCCAGGTGTGAAATTGAGACAATTGAAGACAAGGCATGGCATGGCTTAAACCAGCTCTCAACCTTGGTACTGACAGGAAACCCTATCAAGAGTTTTTCCCCAGGAAGTTTTTCTGGACTAACAAATTTAGAGAATCTGGTGGCTGTGGAGACAAAAATGACCTCTCTAGAGGGTTTCCATATTGGACAGCTTATATCCTTAAAGAAACTAAATGTGGCTCATAATCTTATACATTCCTTTAAGTTGCCTGAATATTTTTCTAATCTGACAAACCTAGAACATGTGGATCTTTCTTATAACTATATTCAAACTATTTCTGTCAAAGACTTACAGTTTCTACGTGAAAATCCCCAAGTCAATCTCTCTTTAGACCTGTCTTTAAACCCAATTGACTCCATTCAAGCCCAAGCCTTTCAGGGAATTAGGCTCCATGAATTGACTCTAAGAAGTAATTTTAATAGCTCAAATGTACTGAAAATGTGCCTTCAAAACATGACTGGTTTACATGTCCATCGGTTGATCTTGGGAGAATTTAAAAATGAAAGGAATCTGGAAAGTTTTGACCGTTCTGTCATGGAAGGACTATGCAATGTGAGCATTGATGAGTTCAGGTTAACATATATAAATCATTTTTCAGATGATATTTATAATCTCAATTGCTTGGCAAATATTTCTGCAATGTCTTTCACAGGTGTACATATAAAACACATAGCAGATGTTCCTAGGCATTTCAAATGGCAATCCTTATCAATCATTAGATGTCATCTTAAGCCTTTTCCAAAGCTGAGTCTACCTTTTCTTAAAAGTTGGACTTTAACTACCAACAGAGAGGATATCAGCTTTGGTCAGTTGGCTCTGCCAAGTCTCAGATATCTAGATCTTAGTAGAAATGCCATGAGCTTTAGAGGTTGCTGTTCTTATTCTGATTTTGGAACAAACAACCTGAAGTACTTAGACCTCAGCTTCAATGGTGTCATCCTGATGAGTGCCAACTTCATGGGTCTAGAAGAGCTGGAATACCTGGACTTTCAGCACTCCACTTTAAAAAAGGTCACAGAATTCTCAGTGTTCTTATCTCTTGAAAAACTTCTTTACCTTGACATCTCTTACACTAATACCAAAATTGACTTTGATGGCATATTTCTTGGCTTGATCAGTCTCAACACTTTAAAAATGGCTGGCAATTCTTTCAAAGACAACACCCTTTCAAATGTCTTTACAAACACAACAAACTTAACATTCCTGGATCTTTCTAAATGCCAACTGGAACAGATATCTAGGGGGGTATTTGACACACTCTACAGACTCCAGTTATTAAACATGAGTCACAACAACCTACTGTTTCTGGATCCATCCCATTATAAACAGCTGTACTCCCTCAGGACTCTTGATTGCAGTTTCAATCGCATAGAGACATCCAAAGGAATACTGCAACATTTTCCAAAGAGTCTAGCCGTCTTCAATCTGACTAATAATTCTGTTGCTTGTATATGTGAATATCAGAATTTCTTGCAGTGGGTCAAGGACCAGAAAATGTTCTTGGTGAATGTTGAACAAATGAAATGTGCATCACCTATAGACATGAAGGCCTCCCTGGTGTTGGATTTTACGAATTCCACCTGTTATATATACAAGACTATCATCAGTGTATCGGTGGTCAGTGTGCTTGTGGTAGCCACTGTAGCATTTCTGATATACCACTTCTATTTTCACCTGATACTTATTGCTGGCTGTAAAAAGTACAGCAGAGGAGAAAGCATCTATGATGCATTTGTGATCTACTCGAGCCAGAATGAGGACTGGGTGAGAAACGAGCTGGTAAAGAATTTAGAAGAAGGAGTGCCCCGCTTTCAGCTTTGCCTTCATTACAGGGACTTTATTCCTGGTGTAGCCATTGCTGCCAACATCATCCAGGAAGGCTTCCACAAGAGCCGGAAAGTTATTGTGGTGGTGTCTAGACACTTTATCCAGAGCCGTTGGTGTATCTTTGAATATGAGATTGCTCAGACATGGCAGTTTCTGAGTAGCCGCTCTGGCATCATCTTCATTGTCCTTGAGAAAGTGGAGAAGTCCTTGCTGAGGCAGCAGGTCGAATTGTATCGCCTTCTTAGCAGAAACACCTACCTCGAGTGGGAGGACAATGCTCTGGGGAGGCACATCTTCTGGAGAAGACTCAAAAAAGCCCTGTTGGATGGAAAAGCCTTGAATCCAGATGAAACATCAGAGGAAGAACAAGAAGCAACAACTTTGACCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T81443-Ab Anti-TLR4/ ARMD10/ CD284 monoclonal antibody
    Target Antigen GM-Tg-g-T81443-Ag TLR4 VLP (virus-like particle)
    ORF Viral Vector pGMLV000034 Human TLR4 Lentivirus plasmid
    ORF Viral Vector pGMAD000817 Human TLR4 Adenovirus plasmid
    ORF Viral Vector pGMAD000929 Rat Tlr4 Adenovirus plasmid
    ORF Viral Vector pGMPC000399 Rat Tlr4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000034 Human TLR4 Lentivirus particle
    ORF Viral Vector vGMAD000817 Human TLR4 Adenovirus particle
    ORF Viral Vector vGMAD000929 Rat Tlr4 Adenovirus particle


    Target information

    Target ID GM-T81443
    Target Name TLR4
    Gene ID 7099, 21898, 574360, 29260, 493698, 403417, 281536, 100066890
    Gene Symbol and Synonyms ARMD10,CD284,hToll,Lps,Ly87,Ran/M1,Rasl2-8,TLR-4,TLR4,TOLL
    Uniprot Accession O00206
    Uniprot Entry Name TLR4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Cancer
    Gene Ensembl ENSG00000136869
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. In silico studies have found a particularly strong binding of surface TLR4 with the spike protein of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the causative agent of Coronavirus disease-2019 (COVID-19). This receptor has also been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness, and with susceptibility to age-related macular degeneration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.