Bovine CD36/GPIIIB/ GPIV ORF/cDNA clone-Adenovirus plasmid (NM_001278621.1)
Pre-made Bovine CD36/GPIIIB/ GPIV adenoviral expression plasmid for CD36 adenovirus packaging, CD36 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to CD36/GPIIIB products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAD000949 | Bovine CD36 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAD000949 |
Gene Name | CD36 |
Accession Number | NM_001278621.1 |
Gene ID | 281052 |
Species | Bovine |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 1419 bp |
Gene Alias | GPIIIB, GPIV, PAS-4 |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGTGCAATCGAAACTGTGGGCTCATTGCTGGTGCTGTCATTGGTGCAGTCCTGGCTGTGTTTGGAGGGATTCTAATGCCAGTTGGAGACATGCTTATTGAGAAGACAATTAAAAAGGAAGTTGTCCTTGAAGAAGGCACAATTGCTTTTAAAAATTGGGTTAAAACAGGCACAGATGTTTACAGACAGTTTTGGATATTTGATGTGCAGAATCCAGATGAAGTGACAGTTAACAGCAGCAAAATTAAAGTTAAGCAAAGAGGTCCTTACACATACAGAGTTCGTTATCTAGCCAAGGAAAATATAACCCAGGACCCTGAGACCCACACGGTCTCTTTCCTGCAGCCCAATGGCGCCATCTTTGAACCCTCGCTATCAGTTGGAACTGAGGATGACACGTTCACCATTCTCAACCTGGCTGTAGCAGCTGCACCACAGCTGTATCCAAATACATTTATGCAAGGAATACTCAATTCATTTATCAAAAAGTCCAAATCTTCTATGTTTCAAAACAGAACTTTGAAAGAACTATTGTGGGGCTATACGGATCCATTCTTGAATTTGGTTCCATATCCTATTACTACTACAATTGGTGTGTTTTATCCTTACAATAATACTGCGGATGGAATTTACAAAGTTTTCAATGGAAAGGACGACATAAGCAAAGTTGCTATAATTGACACATACAAAGGCAGAAAGAATCTCTCCTATTGGTCAAGTTATTGTGACCTGATTAATGGTACAGATGCAGCCTCATTTCCACCTTTTGTTGAGAAGACAAGGGTATTGCAATTTTTCTCCTCTGATATTTGCAGGTCCATCTATGCTGTGTTTGGAGCTGAAATAAATCTGAAAGGAATCCCTGTGTATAGATTTATTCTTCCATCCTTTGCTTTTGCATCTCCATTTCAAAATCCAGACAACCACTGTTTCTGCACAGAAAAAATCATCTCAAAAAATTGTACCTTATATGGTGTGCTAGACATTGGCAAATGCAAAGAAGGAAAACCTGTGTACATTTCACTTCCTCATTTTCTACATGGAAGTCCTGAACTTGCAGAACCTATTGAAAGCTTAAGTCCAAATGAAGAAGAACATAGCACGTACTTAGATGTTGAACCTATAACTGGATTTACTTTACGGTTTGCAAAACGGCTGCAGGTCAACATGCTGGTCAAGCCAGCAAAAAAAATTGAAGCATTGAAGAATCTGAAGCACAACTATATTGTCCCTATTCTTTGGCTTAATGAGACTGGTACCATTGGTGATGAGAAGGCGGAAATGTTCAGAAATCAAGTGACTGGGAAAATAAACCTCCTGGGCCTGGTAGAAATCGTCTTGCTCAGTGTTGGTGTGGTGATGTTTATTGCTTTCATGATTTCATATTGTGCATGCAGATCAAAGAGAGTAAATTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T76286-Ab | Anti-CD36/ BDPLT10/ CHDS7 monoclonal antibody |
Target Antigen | GM-Tg-g-T76286-Ag | CD36 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000435 | Human CD36 Lentivirus plasmid |
ORF Viral Vector | pGMLV001317 | Human CD36 Lentivirus plasmid |
ORF Viral Vector | pGMAD000949 | Bovine CD36 Adenovirus plasmid |
ORF Viral Vector | pGMPC000869 | Human CD36 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000500 | Human CD36 Adenovirus plasmid |
ORF Viral Vector | vGMLV000435 | Human CD36 Lentivirus particle |
ORF Viral Vector | vGMLV001317 | Human CD36 Lentivirus particle |
ORF Viral Vector | vGMAD000949 | Bovine CD36 Adenovirus particle |
ORF Viral Vector | vGMAP000500 | Human CD36 Adenovirus particle |
ORF Viral Vector | pGMLV002386 | Mouse Cd36 Lentivirus plasmid |
Target information
Target ID | GM-T76286 |
Target Name | CD36 |
Gene ID | 948, 12491, 574296, 101093842, 475931, 281052, 100049847 |
Gene Symbol and Synonyms | BDPLT10,CD36,CHDS7,FAT,GP3B,GP4,GPIIIB,GPIV,PAS-4,PASIV,SCARB3 |
Uniprot Accession | P16671 |
Uniprot Entry Name | CD36_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000135218 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.