Human TSPO/BPBS/ BZRP ORF/cDNA clone-Lentivirus plasmid (NM_000714)
Pre-made Human TSPO/BPBS/ BZRP Lentiviral expression plasmid for TSPO lentivirus packaging, TSPO lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TSPO/BPBS products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004600 | Human TSPO Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004600 |
Gene Name | TSPO |
Accession Number | NM_000714 |
Gene ID | 706 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 510 bp |
Gene Alias | BPBS, BZRP, DBI, IBP, MBR, mDRC, PBR, PBS, pk18, PKBS, PTBR |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCCCGCCCTGGGTGCCCGCCATGGGCTTCACGCTGGCGCCCAGCCTGGGGTGCTTCGTGGGCTCCCGCTTTGTCCACGGCGAGGGTCTCCGCTGGTACGCCGGCCTGCAGAAGCCCTCGTGGCACCCGCCCCACTGGGTGCTGGGCCCTGTCTGGGGCACGCTCTACTCAGCCATGGGGTACGGCTCCTACCTGGTCTGGAAAGAGCTGGGAGGCTTCACAGAGAAGGCTGTGGTTCCCCTGGGCCTCTACACTGGGCAGCTGGCCCTGAACTGGGCATGGCCCCCCATCTTCTTTGGTGCCCGACAAATGGGCTGGGCCTTGGTGGATCTCCTGCTGGTCAGTGGGGCGGCGGCAGCCACTACCGTGGCCTGGTACCAGGTGAGCCCGCTGGCCGCCCGCCTGCTCTACCCCTACCTGGCCTGGCTGGCCTTCACGACCACACTCAACTACTGCGTATGGCGGGACAACCATGGCTGGCGTGGGGGACGGCGGCTGCCAGAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0017-Ab | Anti-TSPO monoclonal antibody |
Target Antigen | GM-Tg-g-IP0017-Ag | TSPO protein |
ORF Viral Vector | pGMLP004600 | Human TSPO Lentivirus plasmid |
ORF Viral Vector | vGMLP004600 | Human TSPO Lentivirus particle |
Target information
Target ID | GM-IP0017 |
Target Name | TSPO |
Gene ID | 706, 12257, 711717, 24230, 101087076, 474475, 281033, 100071110 |
Gene Symbol and Synonyms | BPBS,BZRP,DBI,IBP,MBR,mDRC,PBR,PBS,pk18,PKBS,PTBR,Ptbzr,PTBZR02,RATPTBZR02,TSPO,TSPO1 |
Uniprot Accession | P30536, B1AH88 |
Uniprot Entry Name | TSPO_HUMAN,TSPOB_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000100300 |
Target Classification | Not Available |
Present mainly in the mitochondrial compartment of peripheral tissues, the protein encoded by this gene interacts with some benzodiazepines and has different affinities than its endogenous counterpart. The protein is a key factor in the flow of cholesterol into mitochondria to permit the initiation of steroid hormone synthesis. Alternatively spliced transcript variants have been reported; one of the variants lacks an internal exon and is considered non-coding, and the other variants encode the same protein. [provided by RefSeq, Feb 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.