Mouse Tnfsf9/4-1BB-L/ 4-1BBL ORF/cDNA clone-Lentivirus plasmid (NM_009404)

Pre-made Mouse Tnfsf9/4-1BB-L/ 4-1BBL Lentiviral expression plasmid for Tnfsf9 lentivirus packaging, Tnfsf9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to 4-1BBL/Tnfsf9/4-1BB-L products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLPm001942 Mouse Tnfsf9 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLPm001942
Gene Name Tnfsf9
Accession Number NM_009404
Gene ID 21950
Species Mouse
Product Type Lentivirus plasmid (overexpression)
Insert Length 930 bp
Gene Alias 4-1BB-L, 4-1BBL, AI848817, Cd137l, Ly63l
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGACCAGCACACACTTGATGTGGAGGATACCGCGGATGCCAGACATCCAGCAGGTACTTCGTGCCCCTCGGATGCGGCGCTCCTCAGAGATACCGGGCTCCTCGCGGACGCTGCGCTCCTCTCAGATACTGTGCGCCCCACAAATGCCGCGCTCCCCACGGATGCTGCCTACCCTGCGGTTAATGTTCGGGATCGCGAGGCCGCGTGGCCGCCTGCACTGAACTTCTGTTCCCGCCACCCAAAGCTCTATGGCCTAGTCGCTTTGGTTTTGCTGCTTCTGATCGCCGCCTGTGTTCCTATCTTCACCCGCACCGAGCCTCGGCCAGCGCTCACAATCACCACCTCGCCCAACCTGGGTACCCGAGAGAATAATGCAGACCAGGTCACCCCTGTTTCCCACATTGGCTGCCCCAACACTACACAACAGGGCTCTCCTGTGTTCGCCAAGCTACTGGCTAAAAACCAAGCATCGTTGTGCAATACAACTCTGAACTGGCACAGCCAAGATGGAGCTGGGAGCTCATACCTATCTCAAGGTCTGAGGTACGAAGAAGACAAAAAGGAGTTGGTGGTAGACAGTCCCGGGCTCTACTACGTATTTTTGGAACTGAAGCTCAGTCCAACATTCACAAACACAGGCCACAAGGTGCAGGGCTGGGTCTCTCTTGTTTTGCAAGCAAAGCCTCAGGTAGATGACTTTGACAACTTGGCCCTGACAGTGGAACTGTTCCCTTGCTCCATGGAGAACAAGTTAGTGGACCGTTCCTGGAGTCAACTGTTGCTCCTGAAGGCTGGCCACCGCCTCAGTGTGGGTCTGAGGGCTTATCTGCATGGAGCCCAGGATGCATACAGAGACTGGGAGCTGTCTTATCCCAACACCACCAGCTTTGGACTCTTTCTTGTGAAACCCGACAACCCATGGGAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IO001-Ab Anti-TNFL9/ 4-1BBL/ TNFSF9 monoclonal antibody
    Target Antigen GM-Tg-g-IO001-Ag 4-1BBL/TNFSF9 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-IO001 tumor necrosis factor (ligand) superfamily, member 9 (TNFSF9) protein & antibody
    ORF Viral Vector pGMLV000252 Human TNFSF9 Lentivirus plasmid
    ORF Viral Vector pGMLPm001942 Mouse Tnfsf9 Lentivirus plasmid
    ORF Viral Vector vGMLV000252 Human TNFSF9 Lentivirus particle
    ORF Viral Vector vGMLPm001942 Mouse Tnfsf9 Lentivirus particle


    Target information

    Target ID GM-IO001
    Target Name 4-1BBL
    Gene ID 8744, 21950, 700588, 353218, 101087207, 476729, 521748, 102150292
    Gene Symbol and Synonyms 4-1BB-L,4-1BBL,CD137L,Ly63l,TNFSF9,TNLG5A
    Uniprot Accession P41273
    Uniprot Entry Name TNFL9_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000125657
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This transmembrane cytokine is a bidirectional signal transducer that acts as a ligand for TNFRSF9/4-1BB, which is a costimulatory receptor molecule in T lymphocytes. This cytokine and its receptor are involved in the antigen presentation process and in the generation of cytotoxic T cells. The receptor TNFRSF9/4-1BB is absent from resting T lymphocytes but rapidly expressed upon antigenic stimulation. The ligand encoded by this gene, TNFSF9/4-1BBL, has been shown to reactivate anergic T lymphocytes in addition to promoting T lymphocyte proliferation. This cytokine has also been shown to be required for the optimal CD8 responses in CD8 T cells. This cytokine is expressed in carcinoma cell lines, and is thought to be involved in T cell-tumor cell interaction.[provided by RefSeq, Oct 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.