• Catalog ID
    pGMLPm005321
  • Gene Name
    Ccr6
  • Accession Number
  • Gene ID
  • Species
    mouse
  • Product Type
    Lentivirus plasmid (overexpression)
  • Insert Length
    1227 bp
  • Gene Alias
    CC-CKR-6;CCR-6;Cmkbr6;KY411
  • Fluorescent Label
    GFP+PURO
  • Fusion Tag
    3xflag
  • Promoter
    CMV
  • Resistance
    Amplicin
  • Sequence
    ATGAGCACTGCTGGTTGTGTCTGTCAACAGAATAGTCCTCACATTCTTAGGACTGGAGCCTGGATAACCACTGAGGCAGGAGTACCTGGCCAGTCTACTTTGGAGCTCAGCATTTTCTGGGGAATGAATTCCACAGAGTCCTACTTTGGAACGGATGATTATGACAACACAGAGTATTATTCTATTCCTCCAGACCATGGGCCATGCTCCCTAGAAGAGGTCAGAAACTTCACCAAGGTATTTGTGCCAATTGCCTACTCCTTAATATGTGTCTTTGGCCTCCTGGGCAACATTATGGTGGTGATGACCTTTGCCTTCTACAAGAAAGCCAGATCCATGACTGACGTCTACCTGTTGAACATGGCCATCACAGACATACTCTTTGTCCTCACCCTACCGTTCTGGGCAGTTACTCATGCCACCAACACTTGGGTTTTCAGCGATGCACTGTGTAAACTGATGAAAGGCACATATGCGGTCAACTTTAACTGTGGGATGCTGCTCCTGGCCTGTATCAGCATGGACCGGTACATTGCCATCGTCCAGGCAACCAAATCTTTCCGGGTACGCTCCAGAACACTGACGCACAGTAAGGTCATCTGTGTGGCAGTGTGGTTCATCTCCATCATCATCTCAAGCCCTACATTTATCTTCAACAAGAAATACGAGCTGCAGGATCGTGATGTCTGTGAGCCACGGTACAGGTCTGTCTCAGAGCCCATCACGTGGAAGCTGCTGGGTATGGGACTGGAGCTGTTCTTTGGGTTCTTCACCCCTTTGCTGTTTATGGTGTTCTGCTATCTGTTCATTATCAAGACCTTGGTGCAGGCCCAGAACTCCAAGAGGCACAGAGCAATCCGAGTCGTGATCGCTGTGGTTCTCGTGTTCCTGGCTTGTCAGATCCCTCACAACATGGTCCTCCTCGTGACTGCGGTCAACACGGGCAAAGTGGGCCGGAGCTGCAGCACCGAGAAAGTCCTCGCCTACACCAGGAACGTGGCCGAGGTCCTGGCTTTCCTGCATTGCTGCCTCAACCCCGTGTTGTATGCGTTTATTGGACAGAAATTCAGAAACTACTTCATGAAGATCATGAAGGATGTGTGGTGTATGAGAAGGAAGAATAAGATGCCTGGCTTCCTCTGTGCCCGGGTTTACTCGGAAAGCTACATCTCCAGGCAGACCAGTGAGACCGTCGAAAATGATAATGCATCGTCCTTTACCATGTAA

Background Information

Related Products

References