• Catalog ID
    pGMLPm005325
  • Gene Name
    Rnf149
  • Accession Number
  • Gene ID
  • Species
    mouse
  • Product Type
    Lentivirus plasmid (overexpression)
  • Insert Length
    714 bp
  • Gene Alias
    1600023E10Rik;AV037261;C76763;Gm15832;Greul4;OTTMUSG00000026591
  • Fluorescent Label
    GFP+PURO
  • Fusion Tag
    3xflag
  • Promoter
    CMV
  • Resistance
    Amplicin
  • Sequence
    ATGATTAGCTACCCAAAAGGACGGGAAATTTTTGATCTGGTGCAAAAAGGAATTCCAGTAAAAATGCGGATAGAGATTGGTACTCGTCATATGCAGGAGTTCATCAGCGGTCAGTCTGTGGTGTTTGTGGCCATCGCCTTCATCACCATGATGATCATCTCATTAGCATGGCTGATATTCTATTATATACAGCGCTTCCTGTATACTGGCTCACAGTTTGGAAGTCAGAATCATAGGAAGGAGACTAAGAAGGTTATTGGCCAGCTCCCTCTACACACTGTGAAGCATGGCGAGAAGGGAATTGATGTCGATGCTGAGAATTGTGCAGTGTGTATTGAAAACTTTAAAGTCAAAGATGTTATCAGAATCCTGCCATGCAAGCATATTTTTCATAGAATATGCATTGACCCATGGCTTTTGGATCACCGAACGTGTCCAATGTGTAAACTTGATGTCATCAAAGCCCTGGGATATTGGGGGGACCCTGAGGATACGCAGGAGCTACCCACCCCAGAAGCTGCCCCAGGAAGGGTTTCTGTTGGGAATCTGAGTGTGACATCCCAAGATGAGGAGAGGAGTGAAAGCAACCTTCCATCATCTTCCTCGAGCGAGTCTGGGCCACACCGCCCCTGTCTTAAAGAAGATGCAGGGGAGGACACAGCATTACTAGGAGCCGGCAGGAGTGAGCCTCAGCATGGAGGATCCATATGCTAG

Background Information

Related Products

References