• Catalog ID
    pGMLPm005329
  • Gene Name
    Tnfrsf1a
  • Accession Number
  • Gene ID
  • Species
    mouse
  • Product Type
    Lentivirus plasmid (overexpression)
  • Insert Length
    1365 bp
  • Gene Alias
    CD120a;FPF;p55;p55-R;TNF-alphaR1;TNF-R;TNF-R-I;TNF-R1;TNF-R55;TNFalpha-R1;TNFAR;Tnfr-2;Tnfr1;TNFR60;TNFRI;TNFRp55
  • Fluorescent Label
    GFP+PURO
  • Fusion Tag
    3xflag
  • Promoter
    CMV
  • Resistance
    Amplicin
  • Sequence
    ATGGGTCTCCCCACCGTGCCTGGCCTGCTGCTGTCACTGGTGCTCCTGGCTCTGCTGATGGGGATACATCCATCAGGGGTCACTGGACTAGTCCCTTCTCTTGGTGACCGGGAGAAGAGGGATAGCTTGTGTCCCCAAGGAAAGTATGTCCATTCTAAGAACAATTCCATCTGCTGCACCAAGTGCCACAAAGGAACCTACTTGGTGAGTGACTGTCCGAGCCCAGGGCGGGATACAGTCTGCAGGGAGTGTGAAAAGGGCACCTTTACGGCTTCCCAGAATTACCTCAGGCAGTGTCTCAGTTGCAAGACATGTCGGAAAGAAATGTCCCAGGTGGAGATCTCTCCTTGCCAAGCTGACAAGGACACGGTGTGTGGCTGTAAGGAGAACCAGTTCCAACGCTACCTGAGTGAGACACACTTCCAGTGCGTGGACTGCAGCCCCTGCTTCAACGGCACCGTGACAATCCCCTGTAAGGAGACTCAGAACACCGTGTGTAACTGCCATGCAGGGTTCTTTCTGAGAGAAAGTGAGTGCGTCCCTTGCAGCCACTGCAAGAAAAATGAGGAGTGTATGAAGTTGTGCCTACCTCCTCCGCTTGCAAATGTCACAAACCCCCAGGACTCAGGTACTGCGGTGCTGTTGCCCCTGGTTATCTTGCTAGGTCTTTGCCTTCTATCCTTTATCTTCATCAGTTTAATGTGCCGATATCCCCGGTGGAGGCCCGAAGTCTACTCCATCATTTGTAGGGATCCCGTGCCTGTCAAAGAGGAGAAGGCTGGAAAGCCCCTAACTCCAGCCCCCTCCCCAGCCTTCAGCCCCACCTCCGGCTTCAACCCCACTCTGGGCTTCAGCACCCCAGGCTTTAGTTCTCCTGTCTCCAGTACCCCCATCAGCCCCATCTTCGGTCCTAGTAACTGGCACTTCATGCCACCTGTCAGTGAGGTAGTCCCAACCCAGGGAGCTGACCCTCTGCTCTACGAATCACTCTGCTCCGTGCCAGCCCCCACCTCTGTTCAGAAATGGGAAGACTCCGCCCACCCGCAACGTCCTGACAATGCAGACCTTGCGATTCTGTATGCTGTGGTGGATGGCGTGCCTCCAGCGCGCTGGAAGGAGTTCATGCGTTTCATGGGGCTGAGCGAGCACGAGATCGAGAGGCTGGAGATGCAGAACGGGCGCTGCCTGCGCGAGGCTCAGTACAGCATGCTGGAAGCCTGGCGGCGCCGCACGCCGCGCCACGAGGACACGCTGGAAGTAGTGGGCCTCGTGCTTTCCAAGATGAACCTGGCTGGGTGCCTGGAGAATATCCTCGAGGCTCTGAGAAATCCCGCCCCCTCGTCCACGACCCGCCTCCCGCGATAA

Background Information

Related Products

References