• Catalog ID
    pGMLPm005353
  • Gene Name
    Dok7
  • Accession Number
  • Gene ID
  • Species
    mouse
  • Product Type
    Lentivirus plasmid (overexpression)
  • Insert Length
    1824 bp
  • Gene Alias
    A930013K19Rik;AW049091;Dok-7;EF-12;Oit5
  • Fluorescent Label
    GFP+PURO
  • Fusion Tag
    3xflag
  • Promoter
    CMV
  • Resistance
    Amplicin
  • Sequence
    ATGACCGAGGCAGCGCTGGTGGAGGGCCAGGTCAAGCTGCGGGACGGCAAGAAGTGGAAGAGTAGGTGGCTGGTGCTGCGCAAGCCATCGCCGGTGGCAGACTGCCTGCTGATGCTGGTCTACAAGGACAAATGTGAACGCTCCAAGGGCCTTCGGGAGCGCAGCAGCCTCACCCTGGAGGACATCTGTGGCCTGGAGCCTGCCCTGCCCTATGAGGGCCTGGCCCACACTCTGGCCATCATCTGCCTGTCTCAGGCTGTTATGCTGGGCTTCGATAGCCATGAGGCCATGTGTGCCTGGGATACCCGTATCCGCTACGCACTGGGCGAGGTGCACAGGTTCCATGTGACAGTAGCTCCTGGTACCAAACTGGAGAGTGGTCCAGCCACTCTTCACCTCTGCAATGACATTCTGGTCCTGGCCAGAGACATCCCTCCAACCGTCATGGGGCAGTGGAAGCTGTCTGACCTCCGGCGTTACGGGGCTGTTCCGAATGGATTCATCTTCGAAGGCGGGACCAGGTGTGGGTACTGGGCTGGAGTCTTCTTCTTGTCATCAGCTGAGGGAGAGCAGATGAGCTTCCTGTTTGACTGCATCGTCCGAGGCATCTCCCCGACCAAAGGCCCGTTTGGGCTTCGGCCAGTTCTCCCAGACCCGAGTTCTGGGGGACCCTCAGCCTCAGAAGAGCGTGTTGCCCAGGAAGCACTGGAAGCCCTGCAGCTAGAGAAGAGGCTCAGCCTGCTTTCTCACTCTGGCCGGCCAGGCAGTGGAGGGGATGACAGAAGTCTATCCAGTTCCTCTTCTGAGGCTAGCCACTCGGACATCAGCGCCAGCAGCAGGCTCACTGCGTGGCCGGAGCAGTCCTCATCCTCGGCCGGCACATCACAAGAAGGACCAGGGCTGGTGGCTGCCCAGGGCCCAGGAGAAGCCATGCTGGGAGCCTCAAGGCCACCCCTCAAGCCACTGCGGCCTCGGCAGTTACAGGAGGTTGGCCGCCAGAGCTCCTCTGACAGTGGCATTGCCACAGGCAGCCACTCCTCTTACTCTGGCAGCTTCTCCTCTTATGCCGGCAGCAACCTGGACGTGTGGCGGGCCGGTGAGGAATTCGGTTCTCTGCTCAGTCTGCCCCCTGGAGCCAGCGCACCTGAGCCCAGACTGTGTGCCTGCCCACCTGGGGCGGCCGAGTACCAGGTGCCCACGTCACTGAGACACCACTATGACACACCTCGAAGCCTGCGCCAGGCCCCCAGAGACCCAAGCCCAGCTTCTCAGGGCAGCTCTGACCACGGTTCAGCCACAGACTTGGGTGGTCAGGCGCCCACAGGGTGTCCCTCCAGTTGGCTGGGAGCTCGCCGACGGGGACAGGCAACGGAAGGCCCAGGCAGTGACGCTGCGCTGCCGAGTCCATCCCCTGGCGAGTCCTGGGAAGCAGGCAGCCCCCATGCAGGGCCGCCTCCAGCTTTCTTTTTGTCATGTTCAATCTGTGGCGGACTCAAGGTCATGGCTACTTCATCCCCTGGATTCACTGTGACGCATCCAGGATCTCCAGGGCGGGTGGCTGCTGATAGCCCTGGGCCTGAGCGACCACACAGTGAGATGCCCACGTATGTGAATATCCCCATCAGCCCCATCTCCAGACCGCAGCTGCACTACATGGACTTGGAGCTCCCGGGGGCCAGTGCTGGTGTTCGAGGGGCCAGCACCTCCCGCTATGCCCAGATTGACATTGCAGCTACCGAGACAGCACATCGCGTCGGGGTCCGGCATGCGCAGACTCGGGAGGAACGGTTACCAGAGTTGGAGCAGCGGAAGAAGGGGCCCTGA

Background Information

Related Products

References