• Catalog ID
    pGMLPm005414
  • Gene Name
    Smim14
  • Accession Number
  • Gene ID
  • Species
    mouse
  • Product Type
    Lentivirus plasmid (overexpression)
  • Insert Length
    300 bp
  • Gene Alias
    1110003E01Rik;1700127H04Rik;5430439C17Rik;MAd4
  • Fluorescent Label
    GFP+PURO
  • Fusion Tag
    3xflag
  • Promoter
    CMV
  • Resistance
    Amplicin
  • Sequence
    ATGGCTGAAGGAGGATTTGACCCCTGTGAATGTGTCTGCTCTCACGAACATGCTATGAGGAGGCTCATCAATCTGCTCCGGCAGTCCCAGTCCTACTGCACCGACACAGAGTGCCTTCGGGAGTTGCCAGGACCCTCCAGTGACAGTGGCATCAGCATCACTGTGATCCTGATGGCCTGGATGGTGATCGCCATGCTCCTCTTCCTTCTGAGGCCTCCTAACCTGAGAGGCTCCAGCCTCCCTGGAAAGCCCTCCAGTCCTCACAGTGGACAGGACCCGCCAGCCCCTCCCGTGGACTAA

Background Information

Related Products

References