• Catalog ID
    pGMLPm005437
  • Gene Name
    Slc39a7
  • Accession Number
  • Gene ID
  • Species
    mouse
  • Product Type
    Lentivirus plasmid (overexpression)
  • Insert Length
    1431 bp
  • Gene Alias
    AA408174;AI117660;AL024048;H-2Ke4;H2-Ke4;Ke-4;Ke4;Ring5;Zip7
  • Fluorescent Label
    GFP+PURO
  • Fusion Tag
    3xflag
  • Promoter
    CMV
  • Resistance
    Amplicin
  • Sequence
    ATGACCATGGGCCTGCGGGCCCCCCACTGGGTGGCTGTGGGACTGCTGACCTGGGCGGCTTTGGGGCTGCTGGTGGCCGGACACGAGGGTCATGGTGACCTGCACAAAGATGTGGAAGAGGACTTCCATGGCCACAGTCACGGGCACTCACATGAAGATTTCCACCATGGCCACAGCCACGGGCACTCGCATGAAGATTTCCACCATGGCCACGGCCACACTCATGAAAGCATCTGGCATGGGCATGCCCACAGCCACGACCATGGACACTCACGTGAGGAATTACACCATGGCCATAGCCATGGCCACTCCCACGATAGCCTCCACCACGGAGGACATGGACATGCCCATCGTGAACATAGCCATGGGACTTCTAGGGAGGCTGGGGCTCCAGGCATCAAACACCACCTGGACACTGTCACCCTCTGGGCCTACGCACTGGGGGCCACAGTGCTGATCTCCGCAGCTCCGTTCTTCGTGCTGTTCCTCATCCCAGTAGAATCTAACTCTCCCAGGCACCGCTCTCTGCTCCAGATCCTGCTCAGTTTTGCTTCCGGGGGGCTCCTGGGTGATGCGTTCCTCCACCTCATCCCGCATGCCTTGGAACCTCATTCTCACCACGCTCCAGAGCAGCCTGGACATGGACACTCCCACAGTGGCCAGGGCCCCATTCTCTCTGTGGGGCTGTGGGTTCTCAGTGGGATTGTCGCCTTCCTCGTGGTGGAGAAATTTGTGAGACACGTGAAAGGAGGACATGGACACAGTCACGGACACGGAGACAGGCATGCGCATGGAGACAGTCACACCCATGGAGATAGACATGAGTGTTCTTCAAAGGAAAAGCCCAGCACAGAGGAAGAGAAGGAAGTGGGCGGGTTGCGGAAAAGGAGAGGAGGAAACACTGGGCCCAGAGATGGCCCGGTGAAACCTCAGAGCCCTGAAGAAGAAAAAGCAGGCTCAGACCTGCGTGTGTCTGGGTACCTGAATCTGGCTGCTGACTTGGCACACAACTTCACAGACGGTCTGGCCATTGGTGCTTCCTTTCGTGGGGGCCGAGGGCTAGGGATCCTGACCACAATGACAGTCCTGCTGCACGAAGTGCCTCATGAGGTTGGGGATTTTGCCATCCTGGTCCAGTCTGGCTGCAGCAAGAAGCAGGCGATGCGTCTGCAACTCGTGACTGCAATTGGAGCATTGGCAGGCACTGCCTGTGCCCTTCTCACCGAGGGAGGGGCAGTGGACAGTGACGTGGCAGGTGGTGCAGGTCCTGGCTGGGTCCTGCCATTCACTGCAGGCGGATTTATCTACGTAGCAACAGTGTCTGTGCTGCCTGAGCTATTGAGAGAGGCATCTCCACTGCAGTCACTGTTGGAGGTGCTGGGGCTGCTGGGGGGTGTTGCCATGATGGTACTGATTGCCCATCTTGAGTGA

Background Information

Related Products

References