• Catalog ID
    pGMLPm005439
  • Gene Name
    Kcna2
  • Accession Number
  • Gene ID
  • Species
    mouse
  • Product Type
    Lentivirus plasmid (overexpression)
  • Insert Length
    1500 bp
  • Gene Alias
    Akr6a4;Gm10672;Kca1-2;Kv1.2;Mk-2
  • Fluorescent Label
    GFP+PURO
  • Fusion Tag
    3xflag
  • Promoter
    CMV
  • Resistance
    Amplicin
  • Sequence
    ATGACAGTGGCTACCGGAGACCCAGTGGACGAGGCTGCTGCCCTCCCTGGGCACCCACAAGACACCTATGACCCAGAGGCAGACCATGAATGCTGTGAGAGAGTGGTCATCAACATCTCAGGCCTGCGGTTCGAAACTCAGCTAAAGACCTTAGCCCAGTTCCCAGAGACCCTCTTAGGGGACCCCAAGAAACGGATGAGGTACTTCGATCCCCTCCGAAATGAGTACTTTTTTGATCGCAACCGCCCTAGCTTTGATGCCATTTTGTACTACTATCAGTCTGGGGGCAGGTTGAGGCGACCTGTGAACGTGCCCTTAGATATCTTCTCGGAAGAAATCCGGTTTTATGAGCTAGGAGAAGAAGCAATGGAGATGTTTCGGGAGGATGAAGGCTACATCAAGGAAGAAGAGCGTCCTCTGCCTGAAAATGAGTTTCAGAGACAGGTGTGGCTTCTCTTTGAATACCCTGAGAGCTCAGGGCCTGCCAGGATTATAGCCATTGTATCTGTGATGGTCATTCTGATCTCCATCGTCAGCTTCTGTCTGGAAACCTTGCCCATCTTCCGGGATGAGAATGAGGACATGCATGGTGGCGGGGTGACCTTCCACACCTATTCCAACAGCACCATCGGGTACCAGCAGTCCACCTCCTTCACCGACCCTTTCTTCATTGTAGAGACTCTCTGCATCATCTGGTTCTCCTTTGAGTTTCTGGTTAGATTCTTTGCCTGTCCCAGCAAAGCTGGCTTCTTCACCAACATCATGAACATCATTGACATTGTGGCTATCATCCCTTACTTTATCACCCTGGGGACAGAGTTAGCTGAGAAGCCAGAGGACGCCCAGCAAGGCCAGCAGGCCATGTCACTGGCCATTCTCCGTGTCATCCGGTTGGTAAGAGTCTTTAGGATTTTCAAGTTGTCCAGACACTCCAAAGGTCTACAGATTCTAGGTCAGACCCTCAAAGCTAGCATGAGGGAATTGGGCCTCCTGATATTCTTCCTCTTCATTGGGGTCATCCTCTTCTCTAGTGCTGTCTATTTTGCAGAAGCTGATGAGAGAGATTCCCAGTTCCCCAGCATCCCGGATGCTTTCTGGTGGGCAGTCGTCTCCATGACAACTGTAGGCTATGGAGACATGGTTCCAACTACCATTGGGGGGAAGATAGTGGGTTCTCTGTGTGCAATTGCAGGTGTGTTAACCATTGCCTTACCAGTCCCTGTCATAGTGTCTAATTTCAACTACTTCTACCACCGGGAGACAGAGGGAGAGGAGCAGGCCCAGTACTTGCAAGTGACAAGCTGTCCAAAGATCCCGTCCTCCCCTGACCTAAAGAAAAGTAGAAGTGCCTCTACCATAAGTAAGTCTGATTACATGGAGATACAGGAGGGAGTTAACAACAGCAATGAGGACTTTAGAGAGGAGAACTTAAAAACAGCCAACTGTACCTTGGCTAACACAAACTATGTGAATATTACCAAAATGTTAACTGATGTCTGA

Background Information

Related Products

References