• Catalog ID
    pGMLPm005446
  • Gene Name
    Tob2
  • Accession Number
  • Gene ID
  • Species
    mouse
  • Product Type
    Lentivirus plasmid (overexpression)
  • Insert Length
    1038 bp
  • Gene Alias
    2900090N22Rik;4930545K18Rik;AV071822;mKIAA1663
  • Fluorescent Label
    GFP+PURO
  • Fusion Tag
    3xflag
  • Promoter
    CMV
  • Resistance
    Amplicin
  • Sequence
    ATGCAGCTGGAGATCAAAGTGGCCCTCAACTTCATCATCTCCTACTTATACAACAAGCTGCCCCGCCGCAGGGCAGACCTGTTTGGGGAGGAGCTAGAGCGGCTTCTGAGAAAGAAATATGAGGGCCACTGGTACCCGGAGAAGCCGTTGAAGGGTTCTGGCTTCCGCTGTGTCCACATTGGGGAAGTGGTAGACCCTGTGGTGGAGCTGGCTGCCAAGCGGAGCGGCCTAGCTGTGGAGGATGTGCGTGCCAACGTGCCCGAAGAGCTGAGTGTCTGGATTGACCCTTTCGAGGTATCCTACCAGATTGGCGAGAAGGGAGTCGTGAAGGTCCTGTACCTGGGTGACAGTGAGGCGAGTGGTACCCCAGAGCTGGACAAAGAGATCAAGAGCAGCTTCAACCCTGACGCCCAGGTGTTTGTGCCCATCGGCAGCCAGGACAGCTCTCTGTCCAGCTCTCCCTCGCCGTCCTTTGGCCAGTCACCCAGCCCCACCTTCATCCCCCGGTCTGCCCAGCCCATCACCTTTACTACTGCCTCTTTTGCTGCCACCAAATTTGGTTCCACTAAGATGAAGAAGGGTGGTGGGGCATCTGGCGGTGTGAGTGTGGGTGGCAGCGGGGCGGGTGGCCAGCAGCCGCCGCCACAGCAGCCTCGCATGGCCCGCTCACCCACAAAGAACCTGCTGAAGCACAAGAGCCTCTCTCTATCTATGCATTCACTGAACCTCATCCCAGCCAATCCGGCCCCCCAGTCCCAGCTCTCCCCCAATGCCAAGGAGTTTGTGTACAACGGTGGTGGCTCACCCAGCCTCTTCTTCGATGGGGTGGAAGGCCCGAGCACCAGCACCACGGCCCCCTTCGGCAGCGGTGGAGCCAGCACTTGCAACAGCAGCAGCTTTGATGTGTCCCAGGTGTTCGGAGGCGGTGCTAACAGCCTGTTCTTGGAGAAATCGCCCTTTGTGGAAGGCCTCAGCTACAACCTGAATACCATGCAGTATCCCAACCAGCCCTTCCAGCCTGTCGTGCTGGCCAACTGA

Background Information

Related Products

References