• Catalog ID
    pGMLPm005448
  • Gene Name
    Tnfrsf1b
  • Accession Number
  • Gene ID
  • Species
    mouse
  • Product Type
    Lentivirus plasmid (overexpression)
  • Insert Length
    1425 bp
  • Gene Alias
    CD120b;p75;TNF-alphaR2;TNF-R-II;TNF-R2;TNF-R75;TNFalpha-R2;TNFBR;Tnfr-1;Tnfr2;TNFR80;TNFRII
  • Fluorescent Label
    GFP+PURO
  • Fusion Tag
    3xflag
  • Promoter
    CMV
  • Resistance
    Amplicin
  • Sequence
    ATGGCGCCCGCCGCCCTCTGGGTCGCGCTGGTCTTCGAACTGCAGCTGTGGGCCACCGGGCACACAGTGCCCGCCCAGGTTGTCTTGACACCCTACAAACCGGAACCTGGGTACGAGTGCCAGATCTCACAGGAATACTATGACAGGAAGGCTCAGATGTGCTGTGCTAAGTGTCCTCCTGGCCAATATGTGAAACATTTCTGCAACAAGACCTCGGACACCGTGTGTGCGGACTGTGAGGCAAGCATGTATACCCAGGTCTGGAACCAGTTTCGTACATGTTTGAGCTGCAGTTCTTCCTGTACCACTGACCAGGTGGAGATCCGCGCCTGCACTAAACAGCAGAACCGAGTGTGTGCTTGCGAAGCTGGCAGGTACTGCGCCTTGAAAACCCATTCTGGCAGCTGTCGACAGTGCATGAGGCTGAGCAAGTGCGGCCCTGGCTTCGGAGTGGCCAGTTCAAGAGCCCCAAATGGAAATGTGCTATGCAAGGCCTGTGCCCCAGGGACGTTCTCTGACACCACATCATCCACTGATGTGTGCAGGCCCCACCGCATCTGTAGCATCCTGGCTATTCCCGGAAATGCAAGCACAGATGCAGTCTGTGCGCCCGAGTCCCCAACTCTAAGTGCCATCCCAAGGACACTCTACGTATCTCAGCCAGAGCCCACAAGATCCCAACCCCTGGATCAAGAGCCAGGGCCCAGCCAAACTCCAAGCATCCTTACATCGTTGGGTTCAACCCCCATTATTGAACAAAGTACCAAGGGTGGCATCTCTCTTCCAATTGGTCTGATTGTTGGAGTGACATCACTGGGTCTGCTGATGTTAGGACTGGTGAACTGCATCATCCTGGTGCAGAGGAAAAAGAAGCCCTCCTGCCTACAAAGAGATGCCAAGGTGCCTCATGTGCCTGATGAGAAATCCCAGGATGCAGTAGGCCTTGAGCAGCAGCACCTGTTGACCACAGCACCCAGTTCCAGCAGCAGCTCCCTAGAGAGCTCAGCCAGCGCTGGGGACCGAAGGGCGCCCCCTGGGGGCCATCCCCAAGCAAGAGTCATGGCGGAGGCCCAAGGGTTTCAGGAGGCCCGTGCCAGCTCCAGGATTTCAGATTCTTCCCACGGAAGCCACGGGACCCACGTCAACGTCACCTGCATCGTGAACGTCTGTAGCAGCTCTGACCACAGTTCTCAGTGCTCTTCCCAAGCCAGCGCCACAGTGGGAGACCCAGATGCCAAGCCCTCAGCGTCCCCAAAGGATGAGCAGGTCCCCTTCTCTCAGGAGGAGTGTCCGTCTCAGTCCCCGTGTGAGACTACAGAGACACTGCAGAGCCATGAGAAGCCCTTGCCCCTTGGTGTGCCGGATATGGGCATGAAGCCCAGCCAAGCTGGCTGGTTTGATCAGATTGCAGTCAAAGTGGCCTGA

Background Information

Related Products

References