Rat Sirt5 ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_001004256.1)

Pre-made Rat Sirt5/ Adeno-associated virus particle for Sirt5 in-vivo study, mechanism of action (MOA) research and Sirt5-associated gene therapy development.

At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.

Target products collectionGo to SIRT5/Sirt5/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name AAV serotype AAV Grade AAV quantity
vGMAAV000424 Rat Sirt5 Adeno-associate virus(AAV) particle AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF Pilot Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
Research Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAAV000424
Gene Name Sirt5
Accession Number NM_001004256.1
Gene ID 306840
Species Rat
Product Type Adeno-associate virus(AAV) particle (overexpression)
Insert Length 933 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCGACCGCTCCCGGTCGCTCCCGGACGTCTCTTCTCCCAGCTGTGTTGTGGACCGAAGCCTTCAGCCTCCCCACAGAGCAAGATCTGCCTCACCATGGCTCGTCCAAGTTCCAATATGGCAGATTTTCGGAAGTGTTTTGCGAACGCAAAGCACATAGTCATCATCTCGGGGGCTGGTGTTAGTGCGGAGAGTGGGGTTCCAACATTCAGAGGAACCGGAGGCTATTGGAGAAAATGGCAAGCTCAGCACCTGGCGACTCCTCTGGCCTTTGCTCACAACCCCTCACAGGTGTGGGAGTTTTACCACTACCGGAGGGAGGTCATGCGGAACAAGGAACCCAACCCTGGGCACCTGGCCATTGCCCAATGTGAAGCCCGGCTGCGTGACCAGGGCAGACGGGTTGTGGTCATCACCCAGAACATTGATGAGTTACATCGAAAGGCTGGCACCAAGAACCTGCTGGAAATCCACGGAACCTTATTTAAAACTCGGTGTACCTCGTGTGGCAATGTTGCTGAGAACTACAAGAGTCCGATTTGTCCAGCCTTATTGGGAAAAGGGGCCCCAGAACCAGATACTCAAGAGTCCAGAATCCCAGTCCACAAACTTCCCCGGTGCGAGGAGGCAGGATGTGGAGGCTTGCTGCGACCTCACGTGGTGTGGTTTGGAGAAAACCTGGATCCTGCCATTCTGAAAGAGGTGGACAGAGAGCTCGCCCGCTGTGACCTGTGTCTAGTGGTGGGAACGTCCTCTGTGGTCTACCCAGCTGCCATGTTTGCCCCTCAGGTGGCTTCCAGGGGGGTCCCGGTGGCCGAGTTTAACATGGAAACCACCCCAGCCACCAACAGATTCAGGTTTCATTTTCCCGGACCCTGTGGAGTAACTCTTCCTGAAGCCCTTGCTCCCCATGAAACTGAAAGGATTTCTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T91940-Ab Anti-SIRT5 monoclonal antibody
    Target Antigen GM-Tg-g-T91940-Ag SIRT5 protein
    ORF Viral Vector pGMLV000133 Human SIRT5 Lentivirus plasmid
    ORF Viral Vector pGMLV001161 Human SIRT5 Lentivirus plasmid
    ORF Viral Vector pGMLV001245 Rat Sirt5 Lentivirus plasmid
    ORF Viral Vector pGMLV001769 Rat Sirt5 Lentivirus plasmid
    ORF Viral Vector pGMAAV000424 Rat Sirt5 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000230 Human SIRT5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000483 Human SIRT5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000840 Rat Sirt5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000133 Human SIRT5 Lentivirus particle
    ORF Viral Vector vGMLV001161 Human SIRT5 Lentivirus particle
    ORF Viral Vector vGMLV001245 Rat Sirt5 Lentivirus particle
    ORF Viral Vector vGMLV001769 Rat Sirt5 Lentivirus particle
    ORF Viral Vector vGMAAV000424 Rat Sirt5 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-T91940
    Target Name SIRT5
    Gene ID 23408, 68346, 700855, 306840, 101089862, 478726, 507347, 100051757
    Gene Symbol and Synonyms 0610012J09Rik,1500032M05Rik,SIR2L5,SIRT5
    Uniprot Accession Q9NXA8
    Uniprot Entry Name SIR5_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000124523
    Target Classification Not Available

    This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class III of the sirtuin family. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.