Rat Jun ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_021835.3)

Pre-made Rat Jun/ Adeno-associated virus particle for Jun in-vivo study, mechanism of action (MOA) research and Jun-associated gene therapy development.

At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.

Target products collectionGo to JUN/Jun/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name AAV serotype AAV Grade AAV quantity
vGMAAV000691 Rat Jun Adeno-associate virus(AAV) particle AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF Pilot Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
Research Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAAV000691
Gene Name Jun
Accession Number NM_021835.3
Gene ID 24516
Species Rat
Product Type Adeno-associate virus(AAV) particle (overexpression)
Insert Length 1005 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACTGCAAAGATGGAAACGACCTTCTACGACGATGCCCTCAACGCCTCGTTCCTCCAGTCCGAGAGTGGCGCCTACGGCTACAGTAACCCTAAGATTCTGAAGCAGAGCATGACCTTGAACCTGGCCGACCCGGTGGGCAATCTGAAGCCGCACCTCCGAGCCAAGAACTCGGACCTTCTCACGTCGCCCGACGTCGGGCTGCTCAAGCTGGCGTCGCCGGAGCTGGAGCGCCTGATCATCCAGTCCAGCAATGGGCACATCACCACTACACCGACCCCCACTCAGTTCTTGTGCCCCAAGAACGTGACCGACGAGCAGGAGGGCTTCGCCGAAGGCTTCGTGCGCGCCCTAGCTGAACTGCATAGCCAGAATACGCTGCCCAGTGTCACCTCCGCGGCACAACCTGTCAGTGGGGCGGGCATGGTCGCTCCCGCTGTGGCCTCAGTAGCTGGCGCTGGCGGCGGCGGCGGCTACAGCGCCAGCCTGCACAGTGAGCCTCCGGTCTACGCCAACCTCAGCAACTTCAACCCGGGTGCGCTGAGCAGCGGCGGTGGGGCGCCCTCCTATGGCGCGACCGGGCTGGCCTTTCCATCGCAGCCCCAGCAGCAGCAGCAGCCGCCTCAGCCGCCGCACCACTTGCCCCAACAGATCCCGGTGCAGCACCCGCGGCTGCAGGCGCTGAAGGAAGAGCCGCAGACGGTGCCGGAGATGCCGGGAGAGACGCCGCCCTTGTCCCCCATCGACATGGAGTCTCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGGAAAAGGAAGCTGGAGCGGATCGCCCGGCTAGAGGAAAAAGTGAAAACCTTGAAAGCGCAAAACTCCGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACGTTTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T69085-Ab Anti-JUN monoclonal antibody
    Target Antigen GM-Tg-g-T69085-Ag JUN protein
    ORF Viral Vector pGMLV000295 Human JUN Lentivirus plasmid
    ORF Viral Vector pGMLV001213 Rat Jun Lentivirus plasmid
    ORF Viral Vector pGMLV001471 Human JUN Lentivirus plasmid
    ORF Viral Vector pGMAD000140 Human JUN Adenovirus plasmid
    ORF Viral Vector pGMAD000912 Human JUN Adenovirus plasmid
    ORF Viral Vector pGMAAV000691 Rat Jun Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000142 Human JUN Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000535 Human JUN Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-129 Human JUN Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-269 Human JUN Adenovirus plasmid
    ORF Viral Vector vGMLV000295 Human JUN Lentivirus particle
    ORF Viral Vector vGMLV001213 Rat Jun Lentivirus particle
    ORF Viral Vector vGMLV001471 Human JUN Lentivirus particle
    ORF Viral Vector vGMAD000140 Human JUN Adenovirus particle
    ORF Viral Vector vGMAD000912 Human JUN Adenovirus particle
    ORF Viral Vector vGMAAV000691 Rat Jun Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000535 Human JUN Adenovirus particle
    ORF Viral Vector vGMLP-SPh-129 Human JUN Lentivirus particle
    ORF Viral Vector vGMAP-SPh-269 Human JUN Adenovirus particle


    Target information

    Target ID GM-T69085
    Target Name JUN
    Gene ID 3725, 16476, 716452, 24516, 101097261, 609429, 280831, 100067469
    Gene Symbol and Synonyms AP-1,AP1,c-Jun,cJUN,JUN,Junc,p39
    Uniprot Accession P05412
    Uniprot Entry Name JUN_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000177606
    Target Classification Tumor-associated antigen (TAA)

    This gene is the putative transforming gene of avian sarcoma virus 17. It encodes a protein which is highly similar to the viral protein, and which interacts directly with specific target DNA sequences to regulate gene expression. This gene is intronless and is mapped to 1p32-p31, a chromosomal region involved in both translocations and deletions in human malignancies. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.