Rat Crp/Aa1249/ Ab1-341 ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_017096)

Pre-made Rat Crp/Aa1249/ Ab1-341 Adeno-associated virus particle for Crp in-vivo study, mechanism of action (MOA) research and Crp-associated gene therapy development.

At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.

Target products collectionGo to CRP/Crp/Aa1249 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name AAV serotype AAV Grade AAV quantity
vGMAAV000797 Rat Crp Adeno-associate virus(AAV) particle AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF Pilot Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
Research Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAAV000797
Gene Name Crp
Accession Number NM_017096
Gene ID 25419
Species Rat
Product Type Adeno-associate virus(AAV) particle (overexpression)
Insert Length 693 bp
Gene Alias Aa1249, Ab1-341, Ab2-196, Ac1-114, Ac1262, Ac2-069, Ba2-693
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGAAGCTACTATGGTGTCTTCTGATCACGATAAGCTTCTCTCAGGCTTTTGGTCATGAAGACATGTCTAAACAGGCCTTCGTATTTCCCGGAGTGTCAGCTACTGCCTATGTGTCCCTGGAAGCAGAGTCAAAGAAGCCACTGGAAGCCTTCACTGTGTGTCTCTATGCCCACGCTGATGTGAGCCGAAGCTTCAGCATCTTCTCTTACGCTACCAAGACGAGCTTTAACGAGATTCTTCTGTTTTGGACTAGGGGTCAAGGGTTTAGTATTGCAGTAGGTGGGCCTGAAATACTGTTCAGTGCTTCAGAAATTCCTGAGGTACCAACACACATCTGTGCCACCTGGGAGTCTGCTACAGGAATTGTAGAGCTTTGGCTTGACGGGAAACCCAGGGTGCGGAAAAGTCTGCAGAAGGGCTACATTGTGGGGACAAATGCAAGCATCATCTTGGGGCAGGAGCAGGACTCGTATGGCGGTGGCTTTGACGCGAATCAGTCTTTGGTGGGAGACATTGGAGATGTGAACATGTGGGACTTTGTGCTATCTCCAGAACAGATCAATGCAGTCTATGTTGGTAGGGTATTCAGCCCCAATGTTTTGAACTGGCGGGCACTGAAGTATGAAACACACGGTGATGTGTTTATCAAGCCGCAGCTGTGGCCCTTGACTGACTGTTGTGAGTCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0824-Ab Anti-CRP/ PTX1 functional antibody
    Target Antigen GM-Tg-g-SE0824-Ag CRP protein
    Cytokine cks-Tg-g-GM-SE0824 C-reactive protein, pentraxin-related (CRP) protein & antibody
    ORF Viral Vector pGMAAV000165 Human CRP Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000797 Rat Crp Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000461 Human CRP Adenovirus plasmid
    ORF Viral Vector vGMAAV000165 Human CRP Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000797 Rat Crp Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000461 Human CRP Adenovirus particle
    ORF Viral Vector pGMLV002473 Human CRP Lentivirus plasmid


    Target information

    Target ID GM-SE0824
    Target Name CRP
    Gene ID 1401, 12944, 719454, 25419, 101093079, 488629, 527553, 100057752
    Gene Symbol and Synonyms Aa1249,Ab1-341,Ab2-196,Ac1-114,Ac1262,Ac2-069,Ba2-693,CRP,PTX1
    Uniprot Accession P02741
    Uniprot Entry Name CRP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Diagnostics Biomarker, Cytokine Target
    Disease Breast Cancer, cardiovascular disease, Pregnant state, pancreatic, renal, gastrointestinal, tissue damage, Acute coronary syndromes, Cardiovascular Diseases, cardiovascular events, Cardiovascular Events, cardiovascular outcome, coronary ischemic events, infections, Infectious disease: falciparum malaria, Infectious disease: AIDS, Infectious disease: ATL, Infectious disease: hepatitis, Infectious disease: herpes simplex, Infectious disease: syphilis, Infectious disease: TB, Inflammation, Inflammatory reactions, lymphoma, Mediastinal lympadenopathy, melanoma, myeloma, ovarian, Sepsis, neonatal infections, Non-small cell lung carcinoma
    Gene Ensembl ENSG00000132693
    Target Classification Not Available

    The protein encoded by this gene belongs to the pentraxin family which also includes serum amyloid P component protein and pentraxin 3. Pentraxins are involved in complement activation and amplification via communication with complement initiation pattern recognition molecules, but also complement regulation via recruitment of complement regulators. The encoded protein has a calcium dependent ligand binding domain with a distinctive flattened beta-jellyroll structure. It exists in two forms as either a pentamer in circulation or as a nonsoluble monomer in tissues. It is involved in several host defense related functions based on its ability to recognize foreign pathogens and damaged cells of the host and to initiate their elimination by interacting with humoral and cellular effector systems in the blood. Consequently, the level of this protein in plasma increases greatly during acute phase response to tissue injury, infection, or other inflammatory stimuli. Elevated expression of the encoded protein is associated with severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) infection. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.