Rat Txn1/Txn ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_053800.3)
Pre-made Rat Txn1/Txn Adeno-associated virus particle for Txn1 in-vivo study, mechanism of action (MOA) research and Txn1-associated gene therapy development.
At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.
Go
to TXN/Txn1/Txn products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | AAV serotype | AAV Grade | AAV quantity |
vGMAAV000880 | Rat Txn1 Adeno-associate virus(AAV) particle | AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF | Pilot Grade | 1.0E+12VG/ml |
5.0E+12VG/ml | ||||
1E+13VG/ml | ||||
5E+13VG/ml | ||||
1E+14VG/ml | ||||
Research Grade | 1.0E+12VG/ml | |||
5.0E+12VG/ml | ||||
1E+13VG/ml | ||||
5E+13VG/ml | ||||
1E+14VG/ml | ||||
GMP-like Grade | inquiry | |||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAAV000880 |
Gene Name | Txn1 |
Accession Number | NM_053800.3 |
Gene ID | 116484 |
Species | Rat |
Product Type | Adeno-associate virus(AAV) particle (overexpression) |
Insert Length | 318 bp |
Gene Alias | Txn |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTGAAGCTGATCGAGAGCAAGGAAGCTTTTCAGGAGGCCCTGGCCGCTGCGGGAGACAAGCTTGTGGTAGTGGACTTCTCTGCCACGTGGTGTGGACCTTGCAAAATGATCAAGCCCTTCTTTCATTCCCTCTGTGACAAGTATTCCAATGTGGTGTTCCTTGAAGTAGACGTGGATGACTGCCAGGATGTTGCTGCAGACTGTGAAGTCAAATGCATGCCGACCTTCCAGTTCTATAAAAAGGGTCAAAAGGTTGGGGAGTTCTCTGGTGCTAACAAGGAAAAGCTCGAAGCCACTATTACGGAGTTTGCCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T85616-Ab | Anti-THIO/ TXN/ TRDX functional antibody |
Target Antigen | GM-Tg-g-T85616-Ag | TXN protein |
ORF Viral Vector | pGMLV001614 | Rat Txn1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000153 | Human TXN Adenovirus plasmid |
ORF Viral Vector | pGMAD000538 | Rat Txn1 Adenovirus plasmid |
ORF Viral Vector | pGMAAV000880 | Rat Txn1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV000969 | Human TXN Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMPC000200 | Human TXN Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000876 | Human TXN Lentivirus plasmid |
ORF Viral Vector | vGMLV001614 | Rat Txn1 Lentivirus particle |
ORF Viral Vector | vGMAD000153 | Human TXN Adenovirus particle |
ORF Viral Vector | vGMAD000538 | Rat Txn1 Adenovirus particle |
ORF Viral Vector | vGMAAV000880 | Rat Txn1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV000969 | Human TXN Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP000876 | Human TXN Lentivirus particle |
Target information
Target ID | GM-T85616 |
Target Name | TXN |
Gene ID | 7295, 22166, 712587, 116484, 101090655, 474798, 280950, 100033827 |
Gene Symbol and Synonyms | ADF,TRDX,TRX,TRX1,Trx80,TXN,TXN1 |
Uniprot Accession | P10599 |
Uniprot Entry Name | THIO_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000136810 |
Target Classification | Not Available |
The protein encoded by this gene acts as a homodimer and is involved in many redox reactions. The encoded protein is active in the reversible S-nitrosylation of cysteines in certain proteins, which is part of the response to intracellular nitric oxide. This protein is found in the cytoplasm. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.