Rat Cldn1 ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_031699)
Pre-made Rat Cldn1/ Adeno-associated virus particle for Cldn1 in-vivo study, mechanism of action (MOA) research and Cldn1-associated gene therapy development.
At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.
Go
to CLDN1/Cldn1/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | AAV serotype | AAV Grade | AAV quantity |
vGMAAV001060 | Rat Cldn1 Adeno-associate virus(AAV) particle | AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF | Pilot Grade | 1.0E+12VG/ml |
5.0E+12VG/ml | ||||
1E+13VG/ml | ||||
5E+13VG/ml | ||||
1E+14VG/ml | ||||
Research Grade | 1.0E+12VG/ml | |||
5.0E+12VG/ml | ||||
1E+13VG/ml | ||||
5E+13VG/ml | ||||
1E+14VG/ml | ||||
GMP-like Grade | inquiry | |||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAAV001060 |
Gene Name | Cldn1 |
Accession Number | NM_031699 |
Gene ID | 65129 |
Species | Rat |
Product Type | Adeno-associate virus(AAV) particle (overexpression) |
Insert Length | 636 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCAACGCGGGGTTGCAGCTTCTGGGTTTCATCCTGGCTTCGCTGGGATGGATCGGCTCTATCGTCAGCACTGCCCTGCCCCAATGGAAGATTTACTCCTATGCTGGGGACAACATCGTGACTGCTCAGGCCATCTACGAGGGACTGTGGATGTCCTGCGTTTCGCAAAGCACCGGGCAGATACAGTGCAAAGTCTTCGACTCCTTGCTGAATCTGAATAGTACTTTGCAGGCAACCAGAGCCTTGATGGTAATTGGCATCCTGCTGGGGCTGATCGCAATCTTTGTGTCCACCATTGGCATGAAGTGCATGAGGTGCTTAGAAGATGATGAAGTGCAAAAGATGTGGATGGCTGTCATCGGGGGCATAATATTTGTAATTTCAGGTCTGGCGACATTAGTGGCCACAGCATGGTATGGAAATAGAATTGTTCAAGAATTCTATGACCCCATGACCCCTGTCAATGCCAGGTATGAATTTGGCCAGGCTCTCTTTACTGGCTGGGCTGCTGCCTCCCTCTGCCTCCTGGGAGGTGCCCTACTTTCCTGCTCCTGTCCCCGGAAAACAACCTCTTACCCAACACCACGGCCTTATCCCAAGCCAACACCTTCTAGTGGGAAAGACTACGTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0271-Ab | Anti-CLD1/ CLDN1/ ILVASC monoclonal antibody |
Target Antigen | GM-Tg-g-MP0271-Ag | CLDN1 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000077 | Human CLDN1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001928 | Human CLDN1 Lentivirus plasmid |
ORF Viral Vector | pGMAAV001060 | Rat Cldn1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV001101 | Rat Cldn1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMPC000975 | Human CLDN1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000567 | Rat Cldn1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000077 | Human CLDN1 Lentivirus particle |
ORF Viral Vector | vGMLV001928 | Human CLDN1 Lentivirus particle |
ORF Viral Vector | vGMAAV001060 | Rat Cldn1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV001101 | Rat Cldn1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000567 | Rat Cldn1 Adenovirus particle |
Target information
Target ID | GM-MP0271 |
Target Name | CLDN1 |
Gene ID | 9076, 12737, 704330, 65129, 101094619, 608207, 414922, 100059811 |
Gene Symbol and Synonyms | claudin-1,CLD1,CLDN1,ILVASC,SEMP1 |
Uniprot Accession | O95832 |
Uniprot Entry Name | CLD1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000163347 |
Target Classification | Tumor-associated antigen (TAA) |
Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. Loss of function mutations result in neonatal ichthyosis-sclerosing cholangitis syndrome. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.