Rat Cldn1 ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_031699)

Pre-made Rat Cldn1/ Adeno-associated virus particle for Cldn1 in-vivo study, mechanism of action (MOA) research and Cldn1-associated gene therapy development.

At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.

Target products collectionGo to CLDN1/Cldn1/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name AAV serotype AAV Grade AAV quantity
vGMAAV001101 Rat Cldn1 Adeno-associate virus(AAV) particle AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF Pilot Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
Research Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAAV001101
Gene Name Cldn1
Accession Number NM_031699
Gene ID 65129
Species Rat
Product Type Adeno-associate virus(AAV) particle (overexpression)
Insert Length 636 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCAACGCGGGGTTGCAGCTTCTGGGTTTCATCCTGGCTTCGCTGGGATGGATCGGCTCTATCGTCAGCACTGCCCTGCCCCAATGGAAGATTTACTCCTATGCTGGGGACAACATCGTGACTGCTCAGGCCATCTACGAGGGACTGTGGATGTCCTGCGTTTCGCAAAGCACCGGGCAGATACAGTGCAAAGTCTTCGACTCCTTGCTGAATCTGAATAGTACTTTGCAGGCAACCAGAGCCTTGATGGTAATTGGCATCCTGCTGGGGCTGATCGCAATCTTTGTGTCCACCATTGGCATGAAGTGCATGAGGTGCTTAGAAGATGATGAAGTGCAAAAGATGTGGATGGCTGTCATCGGGGGCATAATATTTGTAATTTCAGGTCTGGCGACATTAGTGGCCACAGCATGGTATGGAAATAGAATTGTTCAAGAATTCTATGACCCCATGACCCCTGTCAATGCCAGGTATGAATTTGGCCAGGCTCTCTTTACTGGCTGGGCTGCTGCCTCCCTCTGCCTCCTGGGAGGTGCCCTACTTTCCTGCTCCTGTCCCCGGAAAACAACCTCTTACCCAACACCACGGCCTTATCCCAAGCCAACACCTTCTAGTGGGAAAGACTACGTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0271-Ab Anti-CLD1/ CLDN1/ ILVASC monoclonal antibody
    Target Antigen GM-Tg-g-MP0271-Ag CLDN1 VLP (virus-like particle)
    ORF Viral Vector pGMLV000077 Human CLDN1 Lentivirus plasmid
    ORF Viral Vector pGMLV001928 Human CLDN1 Lentivirus plasmid
    ORF Viral Vector pGMAAV001060 Rat Cldn1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV001101 Rat Cldn1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000975 Human CLDN1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000567 Rat Cldn1 Adenovirus plasmid
    ORF Viral Vector vGMLV000077 Human CLDN1 Lentivirus particle
    ORF Viral Vector vGMLV001928 Human CLDN1 Lentivirus particle
    ORF Viral Vector vGMAAV001060 Rat Cldn1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV001101 Rat Cldn1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000567 Rat Cldn1 Adenovirus particle


    Target information

    Target ID GM-MP0271
    Target Name CLDN1
    Gene ID 9076, 12737, 704330, 65129, 101094619, 608207, 414922, 100059811
    Gene Symbol and Synonyms claudin-1,CLD1,CLDN1,ILVASC,SEMP1
    Uniprot Accession O95832
    Uniprot Entry Name CLD1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000163347
    Target Classification Tumor-associated antigen (TAA)

    Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. Loss of function mutations result in neonatal ichthyosis-sclerosing cholangitis syndrome. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.