Rat Txn1/Txn ORF/cDNA clone-Adenovirus particle (NM_053800.3)

Pre-made Rat Txn1/Txn Adenovirus for Txn1 overexpression in-vitro and in-vivo. The Txn1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified Txn1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to TXN/Txn1/Txn products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000538 Rat Txn1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000538
Gene Name Txn1
Accession Number NM_053800.3
Gene ID 116484
Species Rat
Product Type Adenovirus particle (overexpression)
Insert Length 318 bp
Gene Alias Txn
Fluorescent Reporter
Mammalian Cell Selection Null
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGGTGAAGCTGATCGAGAGCAAGGAAGCTTTTCAGGAGGCCCTGGCCGCTGCGGGAGACAAGCTTGTGGTAGTGGACTTCTCTGCCACGTGGTGTGGACCTTGCAAAATGATCAAGCCCTTCTTTCATTCCCTCTGTGACAAGTATTCCAATGTGGTGTTCCTTGAAGTAGACGTGGATGACTGCCAGGATGTTGCTGCAGACTGTGAAGTCAAATGCATGCCGACCTTCCAGTTCTATAAAAAGGGTCAAAAGGTTGGGGAGTTCTCTGGTGCTAACAAGGAAAAGCTCGAAGCCACTATTACGGAGTTTGCCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T85616-Ab Anti-THIO/ TXN/ TRDX functional antibody
    Target Antigen GM-Tg-g-T85616-Ag TXN protein
    ORF Viral Vector pGMLV001614 Rat Txn1 Lentivirus plasmid
    ORF Viral Vector pGMAD000153 Human TXN Adenovirus plasmid
    ORF Viral Vector pGMAD000538 Rat Txn1 Adenovirus plasmid
    ORF Viral Vector pGMAAV000880 Rat Txn1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000969 Human TXN Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000200 Human TXN Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000876 Human TXN Lentivirus plasmid
    ORF Viral Vector vGMLV001614 Rat Txn1 Lentivirus particle
    ORF Viral Vector vGMAD000153 Human TXN Adenovirus particle
    ORF Viral Vector vGMAD000538 Rat Txn1 Adenovirus particle
    ORF Viral Vector vGMAAV000880 Rat Txn1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000969 Human TXN Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP000876 Human TXN Lentivirus particle


    Target information

    Target ID GM-T85616
    Target Name TXN
    Gene ID 7295, 22166, 712587, 116484, 101090655, 474798, 280950, 100033827
    Gene Symbol and Synonyms ADF,TRDX,TRX,TRX1,Trx80,TXN,TXN1
    Uniprot Accession P10599
    Uniprot Entry Name THIO_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000136810
    Target Classification Not Available

    The protein encoded by this gene acts as a homodimer and is involved in many redox reactions. The encoded protein is active in the reversible S-nitrosylation of cysteines in certain proteins, which is part of the response to intracellular nitric oxide. This protein is found in the cytoplasm. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.