Mouse Atg5/2010107M05Rik/ 3110067M24Rik ORF/cDNA clone-Adenovirus particle (NM_053069.6)

Pre-made Mouse Atg5/2010107M05Rik/ 3110067M24Rik Adenovirus for Atg5 overexpression in-vitro and in-vivo. The Atg5 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified Atg5-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000598 Mouse Atg5 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000598
Gene Name Atg5
Accession Number NM_053069.6
Gene ID 11793
Species Mouse
Product Type Adenovirus particle (overexpression)
Insert Length 828 bp
Gene Alias 2010107M05Rik, 3110067M24Rik, Apg5l, Atg5l, AW319544, C88337, Paddy
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACAGATGACAAAGATGTGCTTCGAGATGTGTGGTTTGGACGAATTCCAACTTGCTTTACTCTCTATCAGGATGAGATAACTGAAAGAGAAGCAGAACCATACTATTTGCTTTTGCCAAGAGTCAGCTATTTGACGTTGGTAACTGACAAAGTGAAAAAGCACTTTCAGAAGGTTATGAGACAAGAAGATGTTAGTGAGATATGGTTTGAATATGAAGGCACACCCCTGAAATGGCATTATCCAATTGGTTTACTATTTGATCTTCTTGCATCAAGTTCAGCTCTTCCTTGGAACATCACAGTACATTTCAAGAGTTTTCCAGAAAAGGACCTTCTACACTGTCCATCCAAGGATGCGGTTGAGGCTCACTTTATGTCGTGTATGAAAGAAGCTGATGCTTTAAAGCATAAAAGTCAAGTGATCAACGAAATGCAGAAAAAAGACCACAAGCAGCTCTGGATGGGACTGCAGAATGACAGATTTGACCAGTTTTGGGCCATCAACCGGAAACTCATGGAATATCCTCCAGAAGAAAATGGATTTCGTTATATCCCCTTTAGAATATATCAGACCACGACGGAGCGGCCTTTCATCCAGAAGCTGTTCCGGCCTGTGGCCGCAGATGGACAGCTGCACACACTTGGAGATCTCCTCAGAGAAGTCTGTCCTTCCGCAGTCGCCCCTGAAGATGGAGAGAAGAGGAGCCAGGTGATGATTCACGGGATAGAGCCAATGCTGGAAACCCCTCTGCAGTGGCTGAGCGAGCATCTGAGCTACCCAGATAACTTTCTTCATATTAGCATTGTCCCCCAGCCAACAGATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    ORF Viral Vector pGMAD000598 Mouse Atg5 Adenovirus plasmid




    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.