Rat Bmp3/PBMP3 ORF/cDNA clone-Adenovirus particle (NM_017105.1)

Pre-made Rat Bmp3/PBMP3 Adenovirus for Bmp3 overexpression in-vitro and in-vivo. The Bmp3 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified Bmp3-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to BMP3/Bmp3/PBMP3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000608 Rat Bmp3 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000608
Gene Name Bmp3
Accession Number NM_017105.1
Gene ID 25667
Species Rat
Product Type Adenovirus particle (overexpression)
Insert Length 1407 bp
Gene Alias PBMP3
Fluorescent Reporter Luciferase
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTGGGGCTCGCGGGCTGCTGTGTCTGTGGCTAGGTTGTTTCTGCCTGAACCTGGCACAGGGACAGAGACCAAATTTGCACCTCCCGGGACTCCGCGGGACTGAGTCAAGCGACCGCATGACAGGTGGTGGCCCGAGCCCGGACCTGAGGCCTCACGACAAGGTGTCAGAGCATATGCTGTGGCTCTATGACAGGTACAGCGGCAGCAACAGAGCCCAGGCTACCCGGACACCGGGCTCGCAGCTCCCGGGTCCCCAACCCCTGCGTGGCGGTAACACGGTTCGTAGCTTCAGAGCCGCAGCCGCAGGAACTCTTCAAAGAAAGGGCTTGCACACTTTTAATCTGACTTCTCTAACCAAGTCTGAGAACATTTTGTCAGCCACACTGTATTTCTACATTGGAGAATTGGTGAACACCAGTGTGAACTGTCCAGAATCCCAAGGTTGTTCCCATGACAGCCAGAGACAACACATCCAGATAGACCTCTCTGCATGGACCCTCCAATCCAACCAAAGCCAGCTCTTGGGTCATCTGTCAGTAGATACGGCCAAACCTTATAGAGACAGCATGTCTTGGCTGTCAAAAGACATCACTCAGCTCTTACGGAAGGCCAAGCAAGACGAGGAGTTTCTCATAGGATTTAACATTACCTCCAGAGCACACGAGCTTCCCAAGAGGATGCTGCTTTTCCCGGAACCTTATATCTTGGTGTATGCCAACGATGCCGCCATTTGTGAGCCTGAAAGCGTGGTATCTAGCCTACAGAGACACCGCGATTTCACAGCAGGAACTGTGCCCAGACTGGATAGCCACGTCAGAGAAGCCCTCTCTGTTGAGAGGAGGAAGAAGCGCTCTACTGGGATCTTGTTGCCATTGCAGAACAACGAGCTCCCTGGGGCCGAGTATCAGTACAAGGAGGCTGGAGTGTGGGAGGAGAGAAAGCCTTACAAGAGCCTTCAGACTCAGCCTCCTGAAAAGAGCCGGAGCAAAAAGAAACAGAGGAAAGGGCCTCATCAAAAGGGACAGACACTGCAGTTTGATGAGCAGACACTGAAGAAGGCGAGGCGAAAGCAGTGGATCGAGCCTCGGAACTGTGCCCGCAGGTACCTTAAAGTGGACTTTGCCGATATTGGCTGGAGCGAATGGATTATCTCCCCCAAGTCATTTGATGCCTACTATTGCTCCGGAGCCTGCCAGTTCCCCATGCCAAAGTCTTTGAAGCCATCAAATCACGCCACCATCCAGAGCATAGTGAGAGCCGTGGGGGTCGTCTCTGGGATTCCTGAGCCCTGCTGTGTTCCGGAGAAGATGTCCTCGCTCAGCATCTTGTTCTTTGACGAGAACAAGAATGTGGTCCTCAAAGTCTATCCTAACATGACAGTAGACTCTTGTGCTTGTAGATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0685-Ab Anti-BMP3/ BMP-3A functional antibody
    Target Antigen GM-Tg-g-SE0685-Ag BMP3 protein
    Cytokine cks-Tg-g-GM-SE0685 bone morphogenetic protein 3 (BMP3) protein & antibody
    ORF Viral Vector pGMAD000608 Rat Bmp3 Adenovirus plasmid
    ORF Viral Vector pGMPC000084 Human BMP3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMAD000608 Rat Bmp3 Adenovirus particle


    Target information

    Target ID GM-SE0685
    Target Name BMP3
    Gene ID 651, 110075, 695432, 25667, 101093182, 100855862, 539527, 100060322
    Gene Symbol and Synonyms 9530029I04Rik,BMP-3,BMP-3A,BMP3,PBMP3
    Uniprot Accession P12645
    Uniprot Entry Name BMP3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Colorectal Cancer
    Gene Ensembl ENSG00000152785
    Target Classification Not Available

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein suppresses osteoblast differentiation, and negatively regulates bone density, by modulating TGF-beta receptor availability to other ligands. [provided by RefSeq, Jul 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.