- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Rat Cdc20/p55cdc ORF/cDNA clone-Adenovirus particle (NM_171993.2)
Pre-made Rat Cdc20/p55cdc Adenovirus for Cdc20 overexpression in-vitro and in-vivo. The Cdc20 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified Cdc20-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to CDC20/Cdc20/p55cdc products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAD000714 | Rat Cdc20 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAD000714 |
| Gene Name | Cdc20 |
| Accession Number | NM_171993.2 |
| Gene ID | 64515 |
| Species | Rat |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1500 bp |
| Gene Alias | p55cdc |
| Fluorescent Reporter | |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGCGCAGTTCGTGTTCGAGAGCGATTTGCATTCACTGCTTCAACTGGACGCGCCCATCCCCAATGCACCGATTGCTCGCTGGCAGCGCAAAGCAAAAGAAGCCACAGGCCCAGCCCCCTCGCCTATGCGGGCCGCCAACAGATCACACAGCGCCGGTCGGACCCCGGGCCGAACTCCTGGCAAATCTAATTCTAAGGTTCAGACCACCCCTAGCAAACCTGGAGGTGACCGCTATATCCCCCAACGTAGTGCTTCCCAAATGGAGGTGGCCAGCTTCCTCTTGAGCAAGGAGAACCAGCCGGAAGACGGGGGTACGCCCACCAAGAAGGAGCATCAGAAAGCCTGGGCTCGGAACCTGAACGGTTTTGATGTGGAGGAAGCCAAGATCCTCAGGCTCAGTGGAAAACCTCAGAATGCCCCAGAAGGCTACCAGAACAGATTGAAAGTACTCTACAGCCAGAAAGCCACGCCTGGCTCCAGTCGGAAGGCTTGCAGATACATTCCTTCCCTGCCAGACAGGATTCTTGATGCCCCTGAAATCCGGAATGACTACTACCTGAATCTTGTCGATTGGAGCTCTGGAAATGTATTAGCTGTGGCACTGGACAACAGTGTGTACTTATGGAACGCTGGTTCCGGTGACATCCTGCAGCTGTTGCAAATGGAGCAGCCTGGGGACTACATATCATCCGTGGCCTGGATCAAAGAGGGCAACTACCTGGCTGTGGGCACCAGTAATGCTGAGGTGCAGCTATGGGATGTGCAGCAGCAGAAACGGCTTCGAAACATGACCAGCCACTCTGCTCGAGTAAGCTCCCTGAGTTGGAACAGCTATATCCTGTCAAGTGGTTCACGATCTGGCCACATCCACCACCACGATGTTCGAGTAGCAGAACACCATGTGGCCACACTGAGTGGCCATAGCCAGGAAGTATGTGGGCTGCGCTGGGCCCCAGATGGACGACATCTGGCAAGCGGTGGCAATGATAACATTGTCAACGTGTGGCCTAGTGGTCCTGGAGAAAGTGGCTGGGTTCCCCTGCAGACATTCACTCAACATCAAGGTGCTGTCAAGGCTGTTGCATGGTGTCCCTGGCAGTCCAATATCCTGGCAACAGGAGGAGGTACCAGTGACCGACACATTCGCATTTGGAACGTCTGCTCTGGAGCCTGTCTGAGTGCTGTGGATGTGCATTCCCAGGTGTGCTCCATCCTCTGGTCTCCCCACTATAAGGAGCTCATCTCAGGCCATGGCTTTGCCCAGAACCAGCTGGTTATTTGGAAGTACCCAACCATGGCCAAGGTGGCAGAGCTCAAAGGTCACACAGCCCGGGTCCTGAGTCTCACCATGAGTCCAGACGGGGCCACAGTGGCATCTGCAGCAGCCGATGAGACTCTGCGGCTCTGGCGCTGCTTTGAGCTGGACCCTGCCCTTCGGCGGGAGCGGGAAAAAGCCAGCACATCTAAAAGTAGCCTCATCCACCAAGGCATCCGGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T85241-Ab | Anti-CDC20 monoclonal antibody |
| Target Antigen | GM-Tg-g-T85241-Ag | CDC20 protein |
| ORF Viral Vector | pGMAD000714 | Rat Cdc20 Adenovirus plasmid |
| ORF Viral Vector | pGMAAV000836 | Rat Cdc20 Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMPC000508 | Human CDC20 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC001032 | Human CDC20 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMLP002664 | Human CDC20 Lentivirus plasmid |
| ORF Viral Vector | vGMAD000714 | Rat Cdc20 Adenovirus particle |
| ORF Viral Vector | vGMAAV000836 | Rat Cdc20 Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMLP002664 | Human CDC20 Lentivirus particle |
| ORF Viral Vector | pGMLV002472 | Human CDC20 Lentivirus plasmid |
Target information
| Target ID | GM-T85241 |
| Target Name | CDC20 |
| Gene ID | 991, 107995, 64515, 101097259, 100855774, 515376, 100053348 |
| Gene Symbol and Synonyms | 2310042N09Rik,bA276H19.3,CDC20,CDC20A,OOMD14,OZEMA14,p55CDC |
| Uniprot Accession | Q12834 |
| Uniprot Entry Name | CDC20_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Breast Cancer |
| Gene Ensembl | ENSG00000117399 |
| Target Classification | Not Available |
CDC20 appears to act as a regulatory protein interacting with several other proteins at multiple points in the cell cycle. It is required for two microtubule-dependent processes, nuclear movement prior to anaphase and chromosome separation. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
