Bovine DGAT2/ARAT ORF/cDNA clone-Adenovirus particle (NM_205793.2)
Pre-made Bovine DGAT2/ARAT Adenovirus for DGAT2 overexpression in-vitro and in-vivo. The DGAT2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified DGAT2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to DGAT2/ARAT products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000758 | Bovine DGAT2 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000758 |
Gene Name | DGAT2 |
Accession Number | NM_205793.2 |
Gene ID | 404129 |
Species | Bovine |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1086 bp |
Gene Alias | ARAT |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGACCCTCATAGCCGCCTACTCCGGGGTCCTGCGAGGCACTGGCTCCAGCATCCTCTCTGCCCTCCAGGACCTGTTTTCTGTCACTTGGCTCAATAGGTCCAAGGTAGAGAAGCAGCTCCAAGTCATCTCGGTGCTACAATGGGTCCTGTCTTTCCTCGTGCTGGGAGTGGCCTGCAGCGTCATCCTCATGTACACATTCTGCACCGATTGCTGGCTCATTGCCGTGCTCTACTTCACCTGGCTGGTGTTTGACTGGAACACACCCAAGAAAGGTGGCAGGAGGTCACAGTGGGTCCGAAACTGGGCTGTGTGGCGCTACTTTCGAGACTACTTTCCCATTCAGCTGGTGAAGACACACAACTTACTGACCAGCAGGAACTACATCTTTGGGTACCATCCCCATGGCATCATGGGCCTGGGTGCCTTCTGCAACTTCAGCACAGAGGCCACAGAAGTAAGCAAGAAGTTCCCTGGCATAAGGCCCTACCTGGCCACGCTGGCCGGCAACTTCCGGATGCCAGTGCTGCGGGAGTACCTGATGTCTGGAGGCATCTGCCCAGTGAACCGGGACACCATAGACTACTTGCTTTCAAAGAATGGGAGTGGCAATGCCATCATCATCGTGGTGGGGGGCGCGGCTGAATCCCTGAGCTCCATGCCCGGCAAGAATGCAGTCACCCTGCGCAATCGCAAGGGCTTTGTGAAACTGGCCCTGCGCCATGGAGCCGACCTGGTTCCCACCTACTCCTTTGGGGAGAATGAGGTGTACAAGCAGGTGATCTTTGAGGAGGGCTCCTGGGGCCGGTGGGTGCAGAAGAAGTTCCAGAAGTACATTGGCTTTGCCCCATGCATCTTCCATGGTCGAGGCCTCTTCTCCTCTGACACCTGGGGGCTGGTGCCCTACTCCAAGCCCATCACCACTGTCGTGGGCGAGCCCATTACCATCCCCAGGCTGGAGCGCCCGACGCAGCAGGACATCGACCTGTACCACGCCATGTACGTGCAAGCCCTGGTGAAGCTCTTCGACCAGCATAAGACCAAGTTCGGCCTCCCGGAGACCGAGGTCCTGGAGGTGAACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0025-Ab | Anti-DGAT2 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0025-Ag | DGAT2 protein |
ORF Viral Vector | pGMAD000758 | Bovine DGAT2 Adenovirus plasmid |
ORF Viral Vector | pGMLP000417 | Human DGAT2 Lentivirus plasmid |
ORF Viral Vector | vGMAD000758 | Bovine DGAT2 Adenovirus particle |
ORF Viral Vector | vGMLP000417 | Human DGAT2 Lentivirus particle |
Target information
Target ID | GM-IP0025 |
Target Name | DGAT2 |
Gene ID | 84649, 67800, 696549, 252900, 101100329, 485185, 404129, 100064387 |
Gene Symbol and Synonyms | 0610010B06Rik,ARAT,DGAT-2,DGAT2,GS1999FULL,HMFN1045 |
Uniprot Accession | Q96PD7 |
Uniprot Entry Name | DGAT2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000062282 |
Target Classification | Not Available |
This gene encodes one of two enzymes which catalyzes the final reaction in the synthesis of triglycerides in which diacylglycerol is covalently bound to long chain fatty acyl-CoAs. The encoded protein catalyzes this reaction at low concentrations of magnesium chloride while the other enzyme has high activity at high concentrations of magnesium chloride. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.