Bovine DGAT2/ARAT ORF/cDNA clone-Adenovirus particle (NM_205793.2)

Pre-made Bovine DGAT2/ARAT Adenovirus for DGAT2 overexpression in-vitro and in-vivo. The DGAT2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified DGAT2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to DGAT2/ARAT products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000758 Bovine DGAT2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000758
Gene Name DGAT2
Accession Number NM_205793.2
Gene ID 404129
Species Bovine
Product Type Adenovirus particle (overexpression)
Insert Length 1086 bp
Gene Alias ARAT
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGAAGACCCTCATAGCCGCCTACTCCGGGGTCCTGCGAGGCACTGGCTCCAGCATCCTCTCTGCCCTCCAGGACCTGTTTTCTGTCACTTGGCTCAATAGGTCCAAGGTAGAGAAGCAGCTCCAAGTCATCTCGGTGCTACAATGGGTCCTGTCTTTCCTCGTGCTGGGAGTGGCCTGCAGCGTCATCCTCATGTACACATTCTGCACCGATTGCTGGCTCATTGCCGTGCTCTACTTCACCTGGCTGGTGTTTGACTGGAACACACCCAAGAAAGGTGGCAGGAGGTCACAGTGGGTCCGAAACTGGGCTGTGTGGCGCTACTTTCGAGACTACTTTCCCATTCAGCTGGTGAAGACACACAACTTACTGACCAGCAGGAACTACATCTTTGGGTACCATCCCCATGGCATCATGGGCCTGGGTGCCTTCTGCAACTTCAGCACAGAGGCCACAGAAGTAAGCAAGAAGTTCCCTGGCATAAGGCCCTACCTGGCCACGCTGGCCGGCAACTTCCGGATGCCAGTGCTGCGGGAGTACCTGATGTCTGGAGGCATCTGCCCAGTGAACCGGGACACCATAGACTACTTGCTTTCAAAGAATGGGAGTGGCAATGCCATCATCATCGTGGTGGGGGGCGCGGCTGAATCCCTGAGCTCCATGCCCGGCAAGAATGCAGTCACCCTGCGCAATCGCAAGGGCTTTGTGAAACTGGCCCTGCGCCATGGAGCCGACCTGGTTCCCACCTACTCCTTTGGGGAGAATGAGGTGTACAAGCAGGTGATCTTTGAGGAGGGCTCCTGGGGCCGGTGGGTGCAGAAGAAGTTCCAGAAGTACATTGGCTTTGCCCCATGCATCTTCCATGGTCGAGGCCTCTTCTCCTCTGACACCTGGGGGCTGGTGCCCTACTCCAAGCCCATCACCACTGTCGTGGGCGAGCCCATTACCATCCCCAGGCTGGAGCGCCCGACGCAGCAGGACATCGACCTGTACCACGCCATGTACGTGCAAGCCCTGGTGAAGCTCTTCGACCAGCATAAGACCAAGTTCGGCCTCCCGGAGACCGAGGTCCTGGAGGTGAACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0025-Ab Anti-DGAT2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0025-Ag DGAT2 protein
    ORF Viral Vector pGMAD000758 Bovine DGAT2 Adenovirus plasmid
    ORF Viral Vector pGMLP000417 Human DGAT2 Lentivirus plasmid
    ORF Viral Vector vGMAD000758 Bovine DGAT2 Adenovirus particle
    ORF Viral Vector vGMLP000417 Human DGAT2 Lentivirus particle


    Target information

    Target ID GM-IP0025
    Target Name DGAT2
    Gene ID 84649, 67800, 696549, 252900, 101100329, 485185, 404129, 100064387
    Gene Symbol and Synonyms 0610010B06Rik,ARAT,DGAT-2,DGAT2,GS1999FULL,HMFN1045
    Uniprot Accession Q96PD7
    Uniprot Entry Name DGAT2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000062282
    Target Classification Not Available

    This gene encodes one of two enzymes which catalyzes the final reaction in the synthesis of triglycerides in which diacylglycerol is covalently bound to long chain fatty acyl-CoAs. The encoded protein catalyzes this reaction at low concentrations of magnesium chloride while the other enzyme has high activity at high concentrations of magnesium chloride. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.