Rat Mgp/Mglap ORF/cDNA clone-Adenovirus particle (NM_012862.2)
Pre-made Rat Mgp/Mglap Adenovirus for Mgp overexpression in-vitro and in-vivo. The Mgp adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified Mgp-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to MGP/Mgp/Mglap products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD001034 | Rat Mgp Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD001034 |
Gene Name | Mgp |
Accession Number | NM_012862.2 |
Gene ID | 25333 |
Species | Rat |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 312 bp |
Gene Alias | Mglap |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGAGCCTGCTCCCTCTGGCCATCCTGGCTGCGCTGGCCGTGGCAGCCCTGTGCTATGAATCTCACGAAAGCATGGAATCCTATGAAGTCAGTCCCTTCACCAACCGGAGAAATGCCAACACCTTTATATCCCCTCAGCAGAGATGGCACGCTAAAGCCCAGGAAAGAGTCCGGGAACTCAACAAGCCTGCCCAGGAGATCAACAGGGAGGCCTGTGATGACTACAAGCTGTGTGAGCGCTACGCCCTGATCTACGGGTACAACGCCGCCTACAACCGCTACTTCAGGCAGCGCCGAGGAGCCAAATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1099-Ab | Anti-MGP/ GIG36/ MGLAP functional antibody |
Target Antigen | GM-Tg-g-SE1099-Ag | MGP protein |
ORF Viral Vector | pGMLV000128 | Rat Mgp Lentivirus plasmid |
ORF Viral Vector | pGMAD001034 | Rat Mgp Adenovirus plasmid |
ORF Viral Vector | pGMLP004798 | Human MGP Lentivirus plasmid |
ORF Viral Vector | vGMLV000128 | Rat Mgp Lentivirus particle |
ORF Viral Vector | vGMAD001034 | Rat Mgp Adenovirus particle |
ORF Viral Vector | vGMLP004798 | Human MGP Lentivirus particle |
Target information
Target ID | GM-SE1099 |
Target Name | MGP |
Gene ID | 4256, 17313, 574116, 25333, 101096741, 100856382, 282660, 100063934 |
Gene Symbol and Synonyms | GIG36,MGLAP,MGP,NTI |
Uniprot Accession | P08493 |
Uniprot Entry Name | MGP_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000111341 |
Target Classification | Not Available |
This gene encodes a member of the osteocalcin/matrix Gla family of proteins. The encoded vitamin K-dependent protein is secreted by chondrocytes and vascular smooth muscle cells, and functions as a physiological inhibitor of ectopic tissue calcification. Carboxylation status of the encoded protein is associated with calcification of the vasculature in human patients with cardiovascular disease and calcification of the synovial membranes in osteoarthritis patients. Mutations in this gene cause Keutel syndrome in human patients, which is characterized by abnormal cartilage calcification, peripheral pulmonary stenosis and facial hypoplasia. [provided by RefSeq, Sep 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.