- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human CALCA/CGRP/ CGRP-I ORF/cDNA clone-Adenovirus particle (BC069760)
Pre-made Human CALCA/CGRP/ CGRP-I Adenovirus for CALCA overexpression in-vitro and in-vivo. The CALCA adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CALCA-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to CALCA/CGRP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000285 | Human CALCA Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000285 |
| Gene Name | CALCA |
| Accession Number | BC069760 |
| Gene ID | 796 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 426 bp |
| Gene Alias | CGRP, CGRP-I, CGRP1, CT, KC |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGGCTTCCAAAAGTTCTCCCCCTTCCTGGCTCTCAGCATCTTGGTCCTGTTGCAGGCAGGCAGCCTCCATGCAGCACCATTCAGGTCTGCCCTGGAGAGCAGCCCAGCAGACCCGGCCACGCTCAGTGAGGACGAAGCGCGCCTCCTGCTGGCTGCACTGGTGCAGGACTATGTGCAGATGAAGGCCAGTGAGCTGGAGCAGGAGCAAGAGAGAGAGGGCTCCAGCCTGGACAGCCCCAGATCTAAGCGGTGCGGTAATCTGAGTACTTGCATGCTGGGCACATACACGCAGGACTTCAACAAGTTTCACACGTTCCCCCAAACTGCAATTGGGGTTGGAGCACCTGGAAAGAAAAGGGATATGTCCAGCGACTTGGAGAGAGACCATCGCCCTCATGTTAGCATGCCCCAGAATGCCAACTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-228 | Pre-Made Galcanezumab biosimilar, Whole mAb, Anti-CALCA;CALCB Antibody: Anti-CT/KC/PCT/CGRP/CALC1/CGRP1/CGRP-I/CGRP-alpha;CALC2/CGRP-II/CGRP2 therapeutic antibody |
| Biosimilar | GMP-Bios-ab-191 | Pre-Made Eptinezumab biosimilar, Whole mAb, Anti-CALCA;CALCB Antibody: Anti-CT/KC/PCT/CGRP/CALC1/CGRP1/CGRP-I/CGRP-alpha;CALC2/CGRP-II/CGRP2 therapeutic antibody |
| Biosimilar | GMP-Bios-ab-222 | Pre-Made Fremanezumab biosimilar, Whole mAb, Anti-CALCA;CALCB Antibody: Anti-CT/KC/PCT/CGRP/CALC1/CGRP1/CGRP-I/CGRP-alpha;CALC2/CGRP-II/CGRP2 therapeutic antibody |
| Target Antibody | GM-Tg-g-T93509-Ab | Anti-CALC/ CALCA/ CALCA functional antibody |
| Target Antigen | GM-Tg-g-T93509-Ag | CALCA protein |
| ORF Viral Vector | pGMLP001920 | Human CALCA Lentivirus plasmid |
| ORF Viral Vector | pGMAP000285 | Human CALCA Adenovirus plasmid |
| ORF Viral Vector | vGMLP001920 | Human CALCA Lentivirus particle |
| ORF Viral Vector | vGMAP000285 | Human CALCA Adenovirus particle |
Target information
| Target ID | GM-T93509 |
| Target Name | CALCA |
| Gene ID | 796, 12310, 700649, 24241, 101095582, 403946 |
| Gene Symbol and Synonyms | CA,Cal1,CAL6,Calc,CALC1,CALCA,calcitonin,CCALCI,CGRP,CGRP-1,CGRP-alpha,CGRP-I,CGRP1,CT,Ctn,KC,PCT,RATCAL6 |
| Uniprot Accession | P01258, P06881 |
| Uniprot Entry Name | CALC_HUMAN,CALCA_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Diagnostics Biomarker, INN Index |
| Disease | Head and Neck Cancer |
| Gene Ensembl | ENSG00000110680 |
| Target Classification | Not Available |
This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
