Rat Csnk2a1 ORF/cDNA clone-Lentivirus particle (NM_053824.2)

Pre-made Rat Csnk2a1/ Lentiviral expression plasmid for Csnk2a1 lentivirus packaging, Csnk2a1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CSNK2A1/Csnk2a1/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001527 Rat Csnk2a1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001527
Gene Name Csnk2a1
Accession Number NM_053824.2
Gene ID 116549
Species Rat
Product Type Lentivirus particle (overexpression)
Insert Length 1176 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCGGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAACACACACAGACCCCGAGAGTACTGGGACTATGAATCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTTGTTCGAAAATTAGGCAGGGGCAAATACAGTGAAGTGTTTGAAGCCATCAATATCACAAATAATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTTTGGAGAATTTAAGAGGTGGGCCCAACATCATCACACTTGCAGACATTGTGAAAGACCCTGTGTCTCGAACCCCTGCCTTGGTTTTTGAACATGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGACATTCGATTTTACATGTATGAAATTCTGAAAGCCCTGGATTATTGTCACAGCATGGGGATTATGCACAGAGACGTGAAACCGCATAATGTCATGATTGATCATGAGCACAGAAAGCTTCGGCTAATAGATTGGGGTTTAGCAGAGTTTTACCATCCTGGCCAAGAGTATAATGTCCGAGTTGCTTCCCGATATTTCAAAGGTCCAGAGCTACTTGTAGATTATCAGATGTACGATTATAGTTTGGATATGTGGAGCTTGGGTTGTATGCTGGCAAGTATGATCTTCCGGAAGGAGCCATTTTTCCATGGACATGACAATTATGATCAGTTGGTGAGGATAGCCAAGGTTCTGGGAACGGAAGATTTATATGACTATATTGACAAGTACAACATTGAATTAGATCCACGTTTCAACGATATCTTGGGCAGACACTCCCGTAAGCGATGGGAACGCTTTGTCCACAGTGAAAACCAGCACCTTGTCAGCCCCGAGGCCTTGGATTTTCTGGACAAGCTGCTGCGATACGACCACCAGTCTCGGCTCACTGCAAGAGAGGCCATGGAGCACCCTTACTTCTACACTGTCGTGAAGGACCAGGCTCGAATGAGTTCGGCTGGCATGGCAGGGGGCAGCACACCTGTCAGTAGCGCCAATATGATGTCAGGGATTTCTTCAGTGCCAACCCCTTCACCCCTGGGACCTCTGGCAGGCTCACCCGTGATTGCTGCTGCCAACTCACTTGGGATACCTGTACCAGCTGCCGCTGGCGCTCAGCAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T51565-Ab Anti-CSNK2A1 monoclonal antibody
    Target Antigen GM-Tg-g-T51565-Ag CSNK2A1 protein
    ORF Viral Vector pGMLV001527 Rat Csnk2a1 Lentivirus plasmid
    ORF Viral Vector pGMAP000354 Human CSNK2A1 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-008 Human CSNK2A1 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-148 Human CSNK2A1 Adenovirus plasmid
    ORF Viral Vector vGMLV001527 Rat Csnk2a1 Lentivirus particle
    ORF Viral Vector vGMAP000354 Human CSNK2A1 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-008 Human CSNK2A1 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-148 Human CSNK2A1 Adenovirus particle


    Target information

    Target ID GM-T51565
    Target Name CSNK2A1
    Gene ID 1457, 12995, 714841, 116549, 101084186, 477185, 282419, 100067965
    Gene Symbol and Synonyms CK II alpha,CK2,CK2A1,Cka1,Cka2,CKII,CSNK2A1,Csnk2a1-rs4,OCNDS
    Uniprot Accession P68400
    Uniprot Entry Name CSK21_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000101266
    Target Classification Kinase

    Casein kinase II is a serine/threonine protein kinase that phosphorylates acidic proteins such as casein. It is involved in various cellular processes, including cell cycle control, apoptosis, and circadian rhythm. The kinase exists as a tetramer and is composed of an alpha, an alpha-prime, and two beta subunits. The alpha subunits contain the catalytic activity while the beta subunits undergo autophosphorylation. The protein encoded by this gene represents the alpha subunit. Multiple transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Apr 2018]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.