Rat Tex261 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_001017537.1)

Pre-made Rat Tex261/ Adeno-associated virus expression plasmid (ITR-vector) for Tex261 AAV packaging, Tex261 AAV production.The purified Rat Tex261/ AAV particle serves as an invaluable asset for in-depth in vivo Tex261 studies, mechanism of action (MOA) research, and the evolution of Tex261-associated gene therapy strategies.

Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.

Target products collectionGo to TEX261/Tex261/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAAV000426 Rat Tex261 Adeno-associate virus(AAV) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAAV000426
Gene Name Tex261
Accession Number NM_001017537.1
Gene ID 297392
Species Rat
Product Type Adeno-associate virus(AAV) plasmid (overexpression)
Insert Length 591 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGGTTCATGTACGTGCTGAGCTGGCTGTCGCTGTTCATCCAGGTGGCATTCATCACTCTGGCCGTCGCGGCTGGACTGTACTACCTTGCAGAGCTGATTGAAGAGTACACGGTGGCCACCAGCAGAATCATCAAATACATGATCTGGTTCTCCACAGCAGTGCTGATTGGCCTCTACGTCTTTGAGCGCTTCCCCACCAGCATGATTGGCGTGGGCCTTTTCACCAACCTGGTCTACTTTGGCCTTCTCCAGACCTTCCCCTTCATCATGCTGACATCACCTAACTTCATCCTGTCATGCGGGCTAGTGGTGGTGAACCATTACCTGGCATTTCAGTTTTTTGCGGAAGAATATTATCCTTTCTCTGAGGTCCTGGCCTACTTCACATTCTGCCTGTGGATAATCCCGTTTGCTTTCTTCGTGTCACTCTCGGCTGGGGAGAATGTCCTGCCCTCCACCATGCAGCCAGGCGATGACGTGGTCTCCAATTACTTCACCAAAGGCAAGCGAGGCAAGCGCTTAGGCATCCTGGTTGTCTTCTCCTTCATCAAAGAGGCCATCCTACCCAGTCGGCAGAAGATATACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1906-Ab Anti-TEX261 monoclonal antibody
    Target Antigen GM-Tg-g-IP1906-Ag TEX261 protein
    ORF Viral Vector pGMAAV000336 Rat Tex261 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000426 Rat Tex261 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMAAV000336 Rat Tex261 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000426 Rat Tex261 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-IP1906
    Target Name TEX261
    Gene ID 113419, 21766, 703863, 297392, 101098533, 481425, 514869, 100060120
    Gene Symbol and Synonyms 3110001O07Rik,TEG-261,TEX261
    Uniprot Accession Q6UWH6
    Uniprot Entry Name TX261_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000144043
    Target Classification Not Available

    Predicted to enable COPII receptor activity. Predicted to be involved in endoplasmic reticulum to Golgi vesicle-mediated transport. Predicted to act upstream of or within positive regulation of apoptotic process. Predicted to be located in cytoplasm. Predicted to be integral component of membrane. Predicted to be active in COPII-coated ER to Golgi transport vesicle. Predicted to be integral component of Golgi membrane and integral component of endoplasmic reticulum membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.