Rat Tex261 ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_001017537.1)
Pre-made Rat Tex261/ Adeno-associated virus particle for Tex261 in-vivo study, mechanism of action (MOA) research and Tex261-associated gene therapy development.
At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.
Go
to TEX261/Tex261/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | AAV serotype | AAV Grade | AAV quantity |
vGMAAV000426 | Rat Tex261 Adeno-associate virus(AAV) particle | AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF | Pilot Grade | 1.0E+12VG/ml |
5.0E+12VG/ml | ||||
1E+13VG/ml | ||||
5E+13VG/ml | ||||
1E+14VG/ml | ||||
Research Grade | 1.0E+12VG/ml | |||
5.0E+12VG/ml | ||||
1E+13VG/ml | ||||
5E+13VG/ml | ||||
1E+14VG/ml | ||||
GMP-like Grade | inquiry | |||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAAV000426 |
Gene Name | Tex261 |
Accession Number | NM_001017537.1 |
Gene ID | 297392 |
Species | Rat |
Product Type | Adeno-associate virus(AAV) particle (overexpression) |
Insert Length | 591 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTGGTTCATGTACGTGCTGAGCTGGCTGTCGCTGTTCATCCAGGTGGCATTCATCACTCTGGCCGTCGCGGCTGGACTGTACTACCTTGCAGAGCTGATTGAAGAGTACACGGTGGCCACCAGCAGAATCATCAAATACATGATCTGGTTCTCCACAGCAGTGCTGATTGGCCTCTACGTCTTTGAGCGCTTCCCCACCAGCATGATTGGCGTGGGCCTTTTCACCAACCTGGTCTACTTTGGCCTTCTCCAGACCTTCCCCTTCATCATGCTGACATCACCTAACTTCATCCTGTCATGCGGGCTAGTGGTGGTGAACCATTACCTGGCATTTCAGTTTTTTGCGGAAGAATATTATCCTTTCTCTGAGGTCCTGGCCTACTTCACATTCTGCCTGTGGATAATCCCGTTTGCTTTCTTCGTGTCACTCTCGGCTGGGGAGAATGTCCTGCCCTCCACCATGCAGCCAGGCGATGACGTGGTCTCCAATTACTTCACCAAAGGCAAGCGAGGCAAGCGCTTAGGCATCCTGGTTGTCTTCTCCTTCATCAAAGAGGCCATCCTACCCAGTCGGCAGAAGATATACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP1906-Ab | Anti-TEX261 monoclonal antibody |
Target Antigen | GM-Tg-g-IP1906-Ag | TEX261 protein |
ORF Viral Vector | pGMAAV000336 | Rat Tex261 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV000426 | Rat Tex261 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | vGMAAV000336 | Rat Tex261 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV000426 | Rat Tex261 Adeno-associate virus(AAV) particle |
Target information
Target ID | GM-IP1906 |
Target Name | TEX261 |
Gene ID | 113419, 21766, 703863, 297392, 101098533, 481425, 514869, 100060120 |
Gene Symbol and Synonyms | 3110001O07Rik,TEG-261,TEX261 |
Uniprot Accession | Q6UWH6 |
Uniprot Entry Name | TX261_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000144043 |
Target Classification | Not Available |
Predicted to enable COPII receptor activity. Predicted to be involved in endoplasmic reticulum to Golgi vesicle-mediated transport. Predicted to act upstream of or within positive regulation of apoptotic process. Predicted to be located in cytoplasm. Predicted to be integral component of membrane. Predicted to be active in COPII-coated ER to Golgi transport vesicle. Predicted to be integral component of Golgi membrane and integral component of endoplasmic reticulum membrane. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.