Human HSD17B13/HMFN0376/ NIIL497 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_178135)
Pre-made Human HSD17B13/HMFN0376/ NIIL497 Adeno-associated virus expression plasmid (ITR-vector) for HSD17B13 AAV packaging, HSD17B13 AAV production.The purified Human HSD17B13/HMFN0376/ NIIL497 AAV particle serves as an invaluable asset for in-depth in vivo HSD17B13 studies, mechanism of action (MOA) research, and the evolution of HSD17B13-associated gene therapy strategies.
Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.
Go
to HSD17B13/HMFN0376 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAAV000803 | Human HSD17B13 Adeno-associate virus(AAV) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAAV000803 |
Gene Name | HSD17B13 |
Accession Number | NM_178135 |
Gene ID | 345275 |
Species | Human |
Product Type | Adeno-associate virus(AAV) plasmid (overexpression) |
Insert Length | 903 bp |
Gene Alias | HMFN0376, NIIL497, SCDR9, SDR16C3 |
Fluorescent Reporter | |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAACATCATCCTAGAAATCCTTCTGCTTCTGATCACCATCATCTACTCCTACTTGGAGTCGTTGGTGAAGTTTTTCATTCCTCAGAGGAGAAAATCTGTGGCTGGGGAGATTGTTCTCATTACTGGAGCTGGGCATGGAATAGGCAGGCAGACTACTTATGAATTTGCAAAACGACAGAGCATATTGGTTCTGTGGGATATTAATAAGCGCGGTGTGGAGGAAACTGCAGCTGAGTGCCGAAAACTAGGCGTCACTGCGCATGCGTATGTGGTAGACTGCAGCAACAGAGAAGAGATCTATCGCTCTCTAAATCAGGTGAAGAAAGAAGTGGGTGATGTAACAATCGTGGTGAATAATGCTGGGACAGTATATCCAGCCGATCTTCTCAGCACCAAGGATGAAGAGATTACCAAGACATTTGAGGTCAACATCCTAGGACATTTTTGGATCACAAAAGCACTTCTTCCATCGATGATGGAGAGAAATCATGGCCACATCGTCACAGTGGCTTCAGTGTGCGGCCACGAAGGGATTCCTTACCTCATCCCATATTGTTCCAGCAAATTTGCCGCTGTTGGCTTTCACAGAGGTCTGACATCAGAACTTCAGGCCTTGGGAAAAACTGGTATCAAAACCTCATGTCTCTGCCCAGTTTTTGTGAATACTGGGTTCACCAAAAATCCAAGCACAAGATTATGGCCTGTATTGGAGACAGATGAAGTCGTAAGAAGTCTGATAGATGGAATACTTACCAATAAGAAAATGATTTTTGTTCCATCGTATATCAATATCTTTCTGAGACTACAGAAGTTTCTTCCTGAACGCGCCTCAGCGATTTTAAATCGTATGCAGAATATTCAATTTGAAGCAGTGGTTGGCCACAAAATCAAAATGAAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0271-Ab | Anti-DHB13/ HSD17B13/ HMFN0376 functional antibody |
Target Antigen | GM-Tg-g-SE0271-Ag | HSD17B13 protein |
ORF Viral Vector | pGMAAV000323 | Human HSD17B13 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV000347 | Human HSD17B13 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV000670 | Human HSD17B13 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV000803 | Human HSD17B13 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP002403 | Human HSD17B13 Lentivirus plasmid |
ORF Viral Vector | vGMAAV000323 | Human HSD17B13 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV000347 | Human HSD17B13 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV000670 | Human HSD17B13 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV000803 | Human HSD17B13 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP002403 | Human HSD17B13 Lentivirus particle |
Target information
Target ID | GM-SE0271 |
Target Name | HSD17B13 |
Gene ID | 345275, 243168, 701104, 101099712, 478468, 618192, 100052769 |
Gene Symbol and Synonyms | FLDP,HMFN0376,HSD17B13,NIIL497,Pan1b,PAN1B-like,SCDR9,SDR16C3 |
Uniprot Accession | Q7Z5P4 |
Uniprot Entry Name | DHB13_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000170509 |
Target Classification | Not Available |
Predicted to enable oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor and steroid dehydrogenase activity. Acts upstream of or within positive regulation of lipid biosynthetic process. Located in lipid droplet. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.