Human HSD17B13/HMFN0376/ NIIL497 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_178135)

Pre-made Human HSD17B13/HMFN0376/ NIIL497 Adeno-associated virus expression plasmid (ITR-vector) for HSD17B13 AAV packaging, HSD17B13 AAV production.The purified Human HSD17B13/HMFN0376/ NIIL497 AAV particle serves as an invaluable asset for in-depth in vivo HSD17B13 studies, mechanism of action (MOA) research, and the evolution of HSD17B13-associated gene therapy strategies.

Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.

Target products collectionGo to HSD17B13/HMFN0376 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAAV000803 Human HSD17B13 Adeno-associate virus(AAV) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAAV000803
Gene Name HSD17B13
Accession Number NM_178135
Gene ID 345275
Species Human
Product Type Adeno-associate virus(AAV) plasmid (overexpression)
Insert Length 903 bp
Gene Alias HMFN0376, NIIL497, SCDR9, SDR16C3
Fluorescent Reporter
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAACATCATCCTAGAAATCCTTCTGCTTCTGATCACCATCATCTACTCCTACTTGGAGTCGTTGGTGAAGTTTTTCATTCCTCAGAGGAGAAAATCTGTGGCTGGGGAGATTGTTCTCATTACTGGAGCTGGGCATGGAATAGGCAGGCAGACTACTTATGAATTTGCAAAACGACAGAGCATATTGGTTCTGTGGGATATTAATAAGCGCGGTGTGGAGGAAACTGCAGCTGAGTGCCGAAAACTAGGCGTCACTGCGCATGCGTATGTGGTAGACTGCAGCAACAGAGAAGAGATCTATCGCTCTCTAAATCAGGTGAAGAAAGAAGTGGGTGATGTAACAATCGTGGTGAATAATGCTGGGACAGTATATCCAGCCGATCTTCTCAGCACCAAGGATGAAGAGATTACCAAGACATTTGAGGTCAACATCCTAGGACATTTTTGGATCACAAAAGCACTTCTTCCATCGATGATGGAGAGAAATCATGGCCACATCGTCACAGTGGCTTCAGTGTGCGGCCACGAAGGGATTCCTTACCTCATCCCATATTGTTCCAGCAAATTTGCCGCTGTTGGCTTTCACAGAGGTCTGACATCAGAACTTCAGGCCTTGGGAAAAACTGGTATCAAAACCTCATGTCTCTGCCCAGTTTTTGTGAATACTGGGTTCACCAAAAATCCAAGCACAAGATTATGGCCTGTATTGGAGACAGATGAAGTCGTAAGAAGTCTGATAGATGGAATACTTACCAATAAGAAAATGATTTTTGTTCCATCGTATATCAATATCTTTCTGAGACTACAGAAGTTTCTTCCTGAACGCGCCTCAGCGATTTTAAATCGTATGCAGAATATTCAATTTGAAGCAGTGGTTGGCCACAAAATCAAAATGAAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0271-Ab Anti-DHB13/ HSD17B13/ HMFN0376 functional antibody
    Target Antigen GM-Tg-g-SE0271-Ag HSD17B13 protein
    ORF Viral Vector pGMAAV000323 Human HSD17B13 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000347 Human HSD17B13 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000670 Human HSD17B13 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000803 Human HSD17B13 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP002403 Human HSD17B13 Lentivirus plasmid
    ORF Viral Vector vGMAAV000323 Human HSD17B13 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000347 Human HSD17B13 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000670 Human HSD17B13 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000803 Human HSD17B13 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP002403 Human HSD17B13 Lentivirus particle


    Target information

    Target ID GM-SE0271
    Target Name HSD17B13
    Gene ID 345275, 243168, 701104, 101099712, 478468, 618192, 100052769
    Gene Symbol and Synonyms FLDP,HMFN0376,HSD17B13,NIIL497,Pan1b,PAN1B-like,SCDR9,SDR16C3
    Uniprot Accession Q7Z5P4
    Uniprot Entry Name DHB13_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000170509
    Target Classification Not Available

    Predicted to enable oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor and steroid dehydrogenase activity. Acts upstream of or within positive regulation of lipid biosynthetic process. Located in lipid droplet. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.