Human TWIST1/ACS3/ bHLHa38 ORF/cDNA clone-Adenovirus plasmid (NM_000474.3)

Pre-made Human TWIST1/ACS3/ bHLHa38 adenoviral expression plasmid for TWIST1 adenovirus packaging, TWIST1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to TWIST1/ACS3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAD000654 Human TWIST1 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAD000654
Gene Name TWIST1
Accession Number NM_000474.3
Gene ID 7291
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 609 bp
Gene Alias ACS3, bHLHa38, BPES2, BPES3, CRS, CRS1, CSO, SCS, SWCOS, TWIST
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATGCAGGACGTGTCCAGCTCGCCAGTCTCGCCGGCCGACGACAGCCTGAGCAACAGCGAGGAAGAGCCAGACCGGCAGCAGCCGCCGAGCGGCAAGCGCGGGGGACGCAAGCGGCGCAGCAGCAGGCGCAGCGCGGGCGGCGGCGCGGGGCCCGGCGGAGCCGCGGGTGGGGGCGTCGGAGGCGGCGACGAGCCGGGCAGCCCGGCCCAGGGCAAGCGCGGCAAGAAGTCTGCGGGCTGTGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGCAGCAGCAGCGGCGGCGGGAGTCCGCAGTCTTACGAGGAGCTGCAGACGCAGCGGGTCATGGCCAACGTGCGGGAGCGCCAGCGCACCCAGTCGCTGAACGAGGCGTTCGCCGCGCTGCGGAAGATCATCCCCACGCTGCCCTCGGACAAGCTGAGCAAGATTCAGACCCTCAAGCTGGCGGCCAGGTACATCGACTTCCTCTACCAGGTCCTCCAGAGCGACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCTCACGAGCGGCTCAGCTACGCCTTCTCGGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T95660-Ab Anti-TWIST1 monoclonal antibody
    Target Antigen GM-Tg-g-T95660-Ag TWIST1 protein
    ORF Viral Vector pGMLV000449 Human TWIST1 Lentivirus plasmid
    ORF Viral Vector pGMLV000590 Human TWIST1 Lentivirus plasmid
    ORF Viral Vector pGMAD000011 Human TWIST1 Adenovirus plasmid
    ORF Viral Vector pGMAD000654 Human TWIST1 Adenovirus plasmid
    ORF Viral Vector pGMPC000348 Human TWIST1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000617 Human TWIST1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000449 Human TWIST1 Lentivirus particle
    ORF Viral Vector vGMLV000590 Human TWIST1 Lentivirus particle
    ORF Viral Vector vGMAD000011 Human TWIST1 Adenovirus particle
    ORF Viral Vector vGMAD000654 Human TWIST1 Adenovirus particle


    Target information

    Target ID GM-T95660
    Target Name TWIST1
    Gene ID 7291, 22160, 574278, 85489, 101094007, 119866614, 782170, 100272214
    Gene Symbol and Synonyms ACS3,bHLHa38,BPES2,BPES3,CRS,CRS1,CSO,M-Twist,Pde,pdt,SCS,Ska10,Ska,SWCOS,TWIST,TWIST1
    Uniprot Accession Q15672
    Uniprot Entry Name TWST1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000122691
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a basic helix-loop-helix (bHLH) transcription factor that plays an important role in embryonic development. The encoded protein forms both homodimers and heterodimers that bind to DNA E box sequences and regulate the transcription of genes involved in cranial suture closure during skull development. This protein may also regulate neural tube closure, limb development and brown fat metabolism. This gene is hypermethylated and overexpressed in multiple human cancers, and the encoded protein promotes tumor cell invasion and metastasis, as well as metastatic recurrence. Mutations in this gene cause Saethre-Chotzen syndrome in human patients, which is characterized by craniosynostosis, ptosis and hypertelorism. [provided by RefSeq, Jul 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.