Human TWIST1/ACS3/ bHLHa38 ORF/cDNA clone-Adenovirus plasmid (NM_000474.3)
Pre-made Human TWIST1/ACS3/ bHLHa38 adenoviral expression plasmid for TWIST1 adenovirus packaging, TWIST1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to TWIST1/ACS3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAD000654 | Human TWIST1 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAD000654 |
Gene Name | TWIST1 |
Accession Number | NM_000474.3 |
Gene ID | 7291 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 609 bp |
Gene Alias | ACS3, bHLHa38, BPES2, BPES3, CRS, CRS1, CSO, SCS, SWCOS, TWIST |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGATGCAGGACGTGTCCAGCTCGCCAGTCTCGCCGGCCGACGACAGCCTGAGCAACAGCGAGGAAGAGCCAGACCGGCAGCAGCCGCCGAGCGGCAAGCGCGGGGGACGCAAGCGGCGCAGCAGCAGGCGCAGCGCGGGCGGCGGCGCGGGGCCCGGCGGAGCCGCGGGTGGGGGCGTCGGAGGCGGCGACGAGCCGGGCAGCCCGGCCCAGGGCAAGCGCGGCAAGAAGTCTGCGGGCTGTGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGCAGCAGCAGCGGCGGCGGGAGTCCGCAGTCTTACGAGGAGCTGCAGACGCAGCGGGTCATGGCCAACGTGCGGGAGCGCCAGCGCACCCAGTCGCTGAACGAGGCGTTCGCCGCGCTGCGGAAGATCATCCCCACGCTGCCCTCGGACAAGCTGAGCAAGATTCAGACCCTCAAGCTGGCGGCCAGGTACATCGACTTCCTCTACCAGGTCCTCCAGAGCGACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCTCACGAGCGGCTCAGCTACGCCTTCTCGGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T95660-Ab | Anti-TWIST1 monoclonal antibody |
Target Antigen | GM-Tg-g-T95660-Ag | TWIST1 protein |
ORF Viral Vector | pGMLV000449 | Human TWIST1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000590 | Human TWIST1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000011 | Human TWIST1 Adenovirus plasmid |
ORF Viral Vector | pGMAD000654 | Human TWIST1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000348 | Human TWIST1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000617 | Human TWIST1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000449 | Human TWIST1 Lentivirus particle |
ORF Viral Vector | vGMLV000590 | Human TWIST1 Lentivirus particle |
ORF Viral Vector | vGMAD000011 | Human TWIST1 Adenovirus particle |
ORF Viral Vector | vGMAD000654 | Human TWIST1 Adenovirus particle |
Target information
Target ID | GM-T95660 |
Target Name | TWIST1 |
Gene ID | 7291, 22160, 574278, 85489, 101094007, 119866614, 782170, 100272214 |
Gene Symbol and Synonyms |
ACS3,bHLHa38,BPES2,BPES3,CRS,CRS1,CSO,M-Twist,Pde,pdt,SCS,Ska10,Ska |
Uniprot Accession | Q15672 |
Uniprot Entry Name | TWST1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000122691 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a basic helix-loop-helix (bHLH) transcription factor that plays an important role in embryonic development. The encoded protein forms both homodimers and heterodimers that bind to DNA E box sequences and regulate the transcription of genes involved in cranial suture closure during skull development. This protein may also regulate neural tube closure, limb development and brown fat metabolism. This gene is hypermethylated and overexpressed in multiple human cancers, and the encoded protein promotes tumor cell invasion and metastasis, as well as metastatic recurrence. Mutations in this gene cause Saethre-Chotzen syndrome in human patients, which is characterized by craniosynostosis, ptosis and hypertelorism. [provided by RefSeq, Jul 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.