Rat Igf2/IGFII/ RNIGF2 ORF/cDNA clone-Adenovirus plasmid (NM_001190162.1)

Pre-made Rat Igf2/IGFII/ RNIGF2 adenoviral expression plasmid for Igf2 adenovirus packaging, Igf2 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to IGF2/Igf2/IGFII products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAD001135 Rat Igf2 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAD001135
Gene Name Igf2
Accession Number NM_001190162.1
Gene ID 24483
Species Rat
Product Type Adenovirus plasmid (overexpression)
Insert Length 543 bp
Gene Alias IGFII, RNIGF2
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGATCCCAGTGGGGAAGTCGATGTTGGTGCTTCTCATCTCTTTGGCCTTCGCCTTGTGCTGCATCGCTGCTTACCGCCCCAGCGAGACTCTGTGCGGAGGGGAGCTTGTTGACACGCTTCAGTTTGTCTGTTCGGACCGCGGCTTCTACTTCAGCAGGCCTTCAAGCCGTGCCAACCGTCGCAGCCGTGGCATCGTGGAAGAGTGCTGCTTCCGCAGCTGCGACTTGGCCCTCCTGGAGACATACTGTGCCACCCCCGCCAAGTCCGAGAGGGACGTGTCTACCTCTCAGGCCGTACTTCCGGACGACTTCCCCAGATACCCCGTGGGCAAGTTCTTCAAATTCGACACCTGGAGACAGTCCGCGGGACGCCTGCGCAGAGGCCTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCGCATGCTTGCCAAAGAGCTCGAAGCGTTCAGAGAGGCCAAGCGCCACCGTCCCCTGATCGTGTTACCACCCAAAGACCCCGCCCACGGGGGAGCCTCTTCGGAGATGTCCAGCAACCATCAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-634 Pre-Made Xentuzumab biosimilar, Whole mAb, Anti-IGF1;IGF2 Antibody: Anti-IGF/IGF-I/IGFI/MGF;C11orf43/GRDF/IGF-II/PP9974/SRS3 therapeutic antibody
    Biosimilar GMP-Bios-ab-160 Pre-Made Dusigitumab biosimilar, Whole mAb, Anti-IGF1;IGF2 Antibody: Anti-IGF/IGF-I/IGFI/MGF;C11orf43/GRDF/IGF-II/PP9974/SRS3 therapeutic antibody
    Target Antibody GM-Tg-g-T90572-Ab Anti-IGF2/ C11orf43/ GRDF functional antibody
    Target Antigen GM-Tg-g-T90572-Ag IGF2 protein
    Cytokine cks-Tg-g-GM-T90572 insulin-like growth factor 2 (IGF2) protein & antibody
    ORF Viral Vector pGMLV000050 Rat Igf2 Lentivirus plasmid
    ORF Viral Vector pGMLV000393 Human IGF2 Lentivirus plasmid
    ORF Viral Vector pGMLV000475 Human IGF2 Lentivirus plasmid
    ORF Viral Vector pGMLV001959 Rat Igf2 Lentivirus plasmid
    ORF Viral Vector pGMAD001135 Rat Igf2 Adenovirus plasmid
    ORF Viral Vector pGMAP000466 Human IGF2 Adenovirus plasmid
    ORF Viral Vector vGMLV000050 Rat Igf2 Lentivirus particle
    ORF Viral Vector vGMLV000393 Human IGF2 Lentivirus particle
    ORF Viral Vector vGMLV000475 Human IGF2 Lentivirus particle
    ORF Viral Vector vGMLV001959 Rat Igf2 Lentivirus particle
    ORF Viral Vector vGMAD001135 Rat Igf2 Adenovirus particle
    ORF Viral Vector vGMAP000466 Human IGF2 Adenovirus particle


    Target information

    Target ID GM-T90572
    Target Name IGF2
    Gene ID 3481, 16002, 710802, 24483, 101093644, 483664, 281240, 100034182
    Gene Symbol and Synonyms C11orf43,GRDF,Igf-2,IGF-II,IGF2,IGFII,M6pr,Mpr,Peg2,PP9974,RNIGF2,SRS3
    Uniprot Accession P01344
    Uniprot Entry Name IGF2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Ovary Cancer
    Gene Ensembl ENSG00000167244
    Target Classification Not Available

    This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.