Rat Igf2/IGFII/ RNIGF2 ORF/cDNA clone-Adenovirus particle (NM_001190162.1)
Pre-made Rat Igf2/IGFII/ RNIGF2 Adenovirus for Igf2 overexpression in-vitro and in-vivo. The Igf2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified Igf2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to IGF2/Igf2/IGFII products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD001135 | Rat Igf2 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD001135 |
Gene Name | Igf2 |
Accession Number | NM_001190162.1 |
Gene ID | 24483 |
Species | Rat |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 543 bp |
Gene Alias | IGFII, RNIGF2 |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGATCCCAGTGGGGAAGTCGATGTTGGTGCTTCTCATCTCTTTGGCCTTCGCCTTGTGCTGCATCGCTGCTTACCGCCCCAGCGAGACTCTGTGCGGAGGGGAGCTTGTTGACACGCTTCAGTTTGTCTGTTCGGACCGCGGCTTCTACTTCAGCAGGCCTTCAAGCCGTGCCAACCGTCGCAGCCGTGGCATCGTGGAAGAGTGCTGCTTCCGCAGCTGCGACTTGGCCCTCCTGGAGACATACTGTGCCACCCCCGCCAAGTCCGAGAGGGACGTGTCTACCTCTCAGGCCGTACTTCCGGACGACTTCCCCAGATACCCCGTGGGCAAGTTCTTCAAATTCGACACCTGGAGACAGTCCGCGGGACGCCTGCGCAGAGGCCTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCGCATGCTTGCCAAAGAGCTCGAAGCGTTCAGAGAGGCCAAGCGCCACCGTCCCCTGATCGTGTTACCACCCAAAGACCCCGCCCACGGGGGAGCCTCTTCGGAGATGTCCAGCAACCATCAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T90572 |
Target Name | IGF2 |
Gene ID | 3481, 16002, 710802, 24483, 101093644, 483664, 281240, 100034182 |
Gene Symbol and Synonyms | C11orf43,GRDF,Igf-2,IGF-II,IGF2,IGFII,M6pr,Mpr,Peg2,PP9974,RNIGF2,SRS3 |
Uniprot Accession | P01344 |
Uniprot Entry Name | IGF2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Ovary Cancer |
Gene Ensembl | ENSG00000167244 |
Target Classification | Not Available |
This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.