Rat Gadd45g ORF/cDNA clone-Adenovirus plasmid (NM_001077640.1)
Pre-made Rat Gadd45g/ adenoviral expression plasmid for Gadd45g adenovirus packaging, Gadd45g adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to GADD45G/Gadd45g/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAD001207 | Rat Gadd45g Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAD001207 |
Gene Name | Gadd45g |
Accession Number | NM_001077640.1 |
Gene ID | 291005 |
Species | Rat |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 480 bp |
Gene Alias | |
Fluorescent Reporter | |
Mammalian Cell Selection | Null |
Fusion Tag | HA(C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACTCTGGAAGAAGTCCGTGGCCAGGATACAGTTCCGGAAAGCACAGCCAGGATGCAGGGCGCCGGGAAAGCATTGCACGAACTTCTGCTGTCGGCGCAGCGCCAGGGCTGTCTGACCGCTGGCGTCTACGAGTCCGCCAAAGTCCTGAATGTGGACCCTGACAATGTGACCTTTTGCGTGCTGGCTGCCGACGAAGAAGATGAGGGCGACATAGCCCTGCAGATCCATTTTACGTTGATCCAGGCGTTCTGCTGCGAGAACGACATTGACATCGTGCGCGTGGGAGACGTGCAGAGGCTGGCGGCGATCGTGGGCGCCGACGACGAGGGGGGCGCGCCGGGAGACTTGCATTGCATCCTCATTTCGAACCCTAATGAAGACACATGGAAGGACCCTGCCTTGGAGAAGCTCAGTTTGTTCTGCGAGGAGAGCCGCAGCTTCAACGACTGGGTGCCCAGCATCACCCTTCCCGAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-TA138-Ab | Anti-GADD45G monoclonal antibody |
Target Antigen | GM-Tg-g-TA138-Ag | GADD45G protein |
ORF Viral Vector | pGMLV000185 | Human GADD45G Lentivirus plasmid |
ORF Viral Vector | pGMLV000519 | Human GADD45G Lentivirus plasmid |
ORF Viral Vector | pGMAD001207 | Rat Gadd45g Adenovirus plasmid |
ORF Viral Vector | pGMLP000504 | Human GADD45G Lentivirus plasmid |
ORF Viral Vector | pGMAP000097 | Human GADD45G Adenovirus plasmid |
ORF Viral Vector | vGMLV000185 | Human GADD45G Lentivirus particle |
ORF Viral Vector | vGMLV000519 | Human GADD45G Lentivirus particle |
ORF Viral Vector | vGMAD001207 | Rat Gadd45g Adenovirus particle |
ORF Viral Vector | vGMLP000504 | Human GADD45G Lentivirus particle |
ORF Viral Vector | vGMAP000097 | Human GADD45G Adenovirus particle |
Target information
Target ID | GM-TA138 |
Target Name | GADD45G |
Gene ID | 10912, 23882, 697835, 291005, 101086509, 484198, 504939, 100054996 |
Gene Symbol and Synonyms | CR6,DDIT2,GADD45G,GADD45gamma,GRP17,OIG37 |
Uniprot Accession | O95257 |
Uniprot Entry Name | GA45G_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000130222 |
Target Classification | Not Available |
This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The protein encoded by this gene responds to environmental stresses by mediating activation of the p38/JNK pathway via MTK1/MEKK4 kinase. The GADD45G is highly expressed in placenta. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.