Rat Gadd45g ORF/cDNA clone-Adenovirus plasmid (NM_001077640.1)

Pre-made Rat Gadd45g/ adenoviral expression plasmid for Gadd45g adenovirus packaging, Gadd45g adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to GADD45G/Gadd45g/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAD001207 Rat Gadd45g Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAD001207
Gene Name Gadd45g
Accession Number NM_001077640.1
Gene ID 291005
Species Rat
Product Type Adenovirus plasmid (overexpression)
Insert Length 480 bp
Gene Alias
Fluorescent Reporter
Mammalian Cell Selection Null
Fusion Tag HA(C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACTCTGGAAGAAGTCCGTGGCCAGGATACAGTTCCGGAAAGCACAGCCAGGATGCAGGGCGCCGGGAAAGCATTGCACGAACTTCTGCTGTCGGCGCAGCGCCAGGGCTGTCTGACCGCTGGCGTCTACGAGTCCGCCAAAGTCCTGAATGTGGACCCTGACAATGTGACCTTTTGCGTGCTGGCTGCCGACGAAGAAGATGAGGGCGACATAGCCCTGCAGATCCATTTTACGTTGATCCAGGCGTTCTGCTGCGAGAACGACATTGACATCGTGCGCGTGGGAGACGTGCAGAGGCTGGCGGCGATCGTGGGCGCCGACGACGAGGGGGGCGCGCCGGGAGACTTGCATTGCATCCTCATTTCGAACCCTAATGAAGACACATGGAAGGACCCTGCCTTGGAGAAGCTCAGTTTGTTCTGCGAGGAGAGCCGCAGCTTCAACGACTGGGTGCCCAGCATCACCCTTCCCGAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA138-Ab Anti-GADD45G monoclonal antibody
    Target Antigen GM-Tg-g-TA138-Ag GADD45G protein
    ORF Viral Vector pGMLV000185 Human GADD45G Lentivirus plasmid
    ORF Viral Vector pGMLV000519 Human GADD45G Lentivirus plasmid
    ORF Viral Vector pGMAD001207 Rat Gadd45g Adenovirus plasmid
    ORF Viral Vector pGMLP000504 Human GADD45G Lentivirus plasmid
    ORF Viral Vector pGMAP000097 Human GADD45G Adenovirus plasmid
    ORF Viral Vector vGMLV000185 Human GADD45G Lentivirus particle
    ORF Viral Vector vGMLV000519 Human GADD45G Lentivirus particle
    ORF Viral Vector vGMAD001207 Rat Gadd45g Adenovirus particle
    ORF Viral Vector vGMLP000504 Human GADD45G Lentivirus particle
    ORF Viral Vector vGMAP000097 Human GADD45G Adenovirus particle


    Target information

    Target ID GM-TA138
    Target Name GADD45G
    Gene ID 10912, 23882, 697835, 291005, 101086509, 484198, 504939, 100054996
    Gene Symbol and Synonyms CR6,DDIT2,GADD45G,GADD45gamma,GRP17,OIG37
    Uniprot Accession O95257
    Uniprot Entry Name GA45G_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000130222
    Target Classification Not Available

    This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The protein encoded by this gene responds to environmental stresses by mediating activation of the p38/JNK pathway via MTK1/MEKK4 kinase. The GADD45G is highly expressed in placenta. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.