Rat Gadd45g ORF/cDNA clone-Adenovirus particle (NM_001077640.1)

Pre-made Rat Gadd45g/ Adenovirus for Gadd45g overexpression in-vitro and in-vivo. The Gadd45g adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified Gadd45g-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to GADD45G/Gadd45g/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD001207 Rat Gadd45g Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD001207
Gene Name Gadd45g
Accession Number NM_001077640.1
Gene ID 291005
Species Rat
Product Type Adenovirus particle (overexpression)
Insert Length 480 bp
Gene Alias
Fluorescent Reporter
Mammalian Cell Selection Null
Fusion Tag HA(C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACTCTGGAAGAAGTCCGTGGCCAGGATACAGTTCCGGAAAGCACAGCCAGGATGCAGGGCGCCGGGAAAGCATTGCACGAACTTCTGCTGTCGGCGCAGCGCCAGGGCTGTCTGACCGCTGGCGTCTACGAGTCCGCCAAAGTCCTGAATGTGGACCCTGACAATGTGACCTTTTGCGTGCTGGCTGCCGACGAAGAAGATGAGGGCGACATAGCCCTGCAGATCCATTTTACGTTGATCCAGGCGTTCTGCTGCGAGAACGACATTGACATCGTGCGCGTGGGAGACGTGCAGAGGCTGGCGGCGATCGTGGGCGCCGACGACGAGGGGGGCGCGCCGGGAGACTTGCATTGCATCCTCATTTCGAACCCTAATGAAGACACATGGAAGGACCCTGCCTTGGAGAAGCTCAGTTTGTTCTGCGAGGAGAGCCGCAGCTTCAACGACTGGGTGCCCAGCATCACCCTTCCCGAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA138-Ab Anti-GADD45G monoclonal antibody
    Target Antigen GM-Tg-g-TA138-Ag GADD45G protein
    ORF Viral Vector pGMLV000185 Human GADD45G Lentivirus plasmid
    ORF Viral Vector pGMLV000519 Human GADD45G Lentivirus plasmid
    ORF Viral Vector pGMAD001207 Rat Gadd45g Adenovirus plasmid
    ORF Viral Vector pGMLP000504 Human GADD45G Lentivirus plasmid
    ORF Viral Vector pGMAP000097 Human GADD45G Adenovirus plasmid
    ORF Viral Vector vGMLV000185 Human GADD45G Lentivirus particle
    ORF Viral Vector vGMLV000519 Human GADD45G Lentivirus particle
    ORF Viral Vector vGMAD001207 Rat Gadd45g Adenovirus particle
    ORF Viral Vector vGMLP000504 Human GADD45G Lentivirus particle
    ORF Viral Vector vGMAP000097 Human GADD45G Adenovirus particle


    Target information

    Target ID GM-TA138
    Target Name GADD45G
    Gene ID 10912, 23882, 697835, 291005, 101086509, 484198, 504939, 100054996
    Gene Symbol and Synonyms CR6,DDIT2,GADD45G,GADD45gamma,GRP17,OIG37
    Uniprot Accession O95257
    Uniprot Entry Name GA45G_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000130222
    Target Classification Not Available

    This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The protein encoded by this gene responds to environmental stresses by mediating activation of the p38/JNK pathway via MTK1/MEKK4 kinase. The GADD45G is highly expressed in placenta. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.