Human ALKBH5/ABH5/OFOXD ORF/cDNA clone-Adenovirus plasmid (NM_017758.4)

Cat. No.: pGMAD001301
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ALKBH5/ABH5/OFOXD adenoviral expression plasmid for ALKBH5 adenovirus packaging, ALKBH5 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to ALKBH5/ABH5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAD001301
Gene Name ALKBH5
Accession Number NM_017758.4
Gene ID 54890
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1185 bp
Gene Alias ABH5,OFOXD,OFOXD1
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCGGCCGCCAGCGGCTACACGGACCTGCGTGAGAAGCTCAAGTCCATGACGTCCCGGGACAACTATAAGGCGGGCAGCCGGGAGGCCGCCGCCGCTGCCGCAGCCGCCGTAGCCGCCGCAGCCGCAGCCGCCGCTGCCGCCGAACCTTACCCTGTGTCCGGGGCCAAGCGCAAGTATCAGGAGGACTCGGACCCCGAGCGCAGCGACTATGAGGAGCAGCAGCTGCAGAAGGAGGAGGAGGCGCGCAAGGTGAAGAGCGGCATCCGCCAGATGCGCCTCTTCAGCCAGGACGAGTGCGCCAAGATCGAGGCCCGCATTGACGAGGTGGTGTCCCGCGCTGAGAAGGGCCTGTACAACGAGCACACGGTGGACCGGGCCCCACTGCGCAACAAGTACTTCTTCGGCGAAGGCTACACTTACGGCGCCCAGCTGCAGAAGCGCGGGCCCGGCCAGGAGCGCCTCTACCCGCCGGGCGACGTGGACGAGATCCCCGAGTGGGTGCACCAGCTGGTGATCCAAAAGCTGGTGGAGCACCGCGTCATCCCCGAGGGCTTCGTCAACAGCGCCGTCATCAACGACTACCAGCCCGGCGGCTGCATCGTGTCTCACGTGGACCCCATCCACATCTTCGAGCGCCCCATCGTGTCCGTGTCCTTCTTTAGCGACTCTGCGCTGTGCTTCGGCTGCAAGTTCCAGTTCAAGCCTATTCGGGTGTCGGAACCAGTGCTTTCCCTGCCGGTGCGCAGGGGAAGCGTGACTGTGCTCAGTGGATATGCTGCTGATGAAATCACTCACTGCATACGGCCTCAGGACATCAAGGAGCGCCGAGCAGTCATCATCCTCAGGAAGACAAGATTAGATGCACCCCGGTTGGAAACAAAGTCCCTGAGCAGCTCCGTGTTACCACCCAGCTATGCTTCAGATCGCCTGTCAGGAAACAACAGGGACCCTGCTCTGAAACCCAAGCGGTCCCACCGCAAGGCAGACCCTGATGCTGCCCACAGGCCACGGATCCTGGAGATGGACAAGGAAGAGAACCGGCGCTCGGTGCTGCTGCCCACACACCGGCGGAGGGGTAGCTTCAGCTCTGAGAACTACTGGCGCAAGTCATACGAGTCCTCAGAGGACTGCTCTGAGGCAGCAGGCAGCCCTGCCCGAAAGGTGAAGATGCGGCGGCACTGA
ORF Protein Sequence MAAASGYTDLREKLKSMTSRDNYKAGSREAAAAAAAAVAAAAAAAAAAEPYPVSGAKRKYQEDSDPERSDYEEQQLQKEEEARKVKSGIRQMRLFSQDECAKIEARIDEVVSRAEKGLYNEHTVDRAPLRNKYFFGEGYTYGAQLQKRGPGQERLYPPGDVDEIPEWVHQLVIQKLVEHRVIPEGFVNSAVINDYQPGGCIVSHVDPIHIFERPIVSVSFFSDSALCFGCKFQFKPIRVSEPVLSLPVRRGSVTVLSGYAADEITHCIRPQDIKERRAVIILRKTRLDAPRLETKSLSSSVLPPSYASDRLSGNNRDPALKPKRSHRKADPDAAHRPRILEMDKEENRRSVLLPTHRRRGSFSSENYWRKSYESSEDCSEAAGSPARKVKMRRH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0327-Ab Anti-ALKBH5 monoclonal antibody
    Target Antigen GM-Tg-g-IP0327-Ag ALKBH5 protein
    ORF Viral Vector pGMLV000810 Human ALKBH5 Lentivirus plasmid
    ORF Viral Vector pGMLV001042 Human ALKBH5 Lentivirus plasmid
    ORF Viral Vector pGMLV001170 Human ALKBH5 Lentivirus plasmid
    ORF Viral Vector pGMAD001301 Human ALKBH5 Adenovirus plasmid
    ORF Viral Vector pGMPC000506 Human ALKBH5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000728 Human ALKBH5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000812 Human ALKBH5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000923 Human ALKBH5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000810 Human ALKBH5 Lentivirus particle
    ORF Viral Vector vGMLV001042 Human ALKBH5 Lentivirus particle
    ORF Viral Vector vGMLV001170 Human ALKBH5 Lentivirus particle
    ORF Viral Vector vGMAD001301 Human ALKBH5 Adenovirus particle


    Target information

    Target ID GM-IP0327
    Target Name ALKBH5
    Gene ID 54890, 268420, 700205, 303193, 101100260, 609383, 533303, 100050716
    Gene Symbol and Synonyms ABH5,ALKBH5,E130207K11,OFOXD,OFOXD1,RGD1309496
    Uniprot Accession Q6P6C2
    Uniprot Entry Name ALKB5_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000091542
    Target Classification Not Available

    Enables mRNA N6-methyladenosine dioxygenase activity. Involved in RNA metabolic process; mRNA export from nucleus; and response to hypoxia. Located in Golgi apparatus; cytosol; and nuclear speck. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.