Human MFF/C2orf33/EMPF2 ORF/cDNA clone-Lentivirus plasmid (NM_020194)

Cat. No.: pGMLP-SPh-099
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MFF/C2orf33/EMPF2 Lentiviral expression plasmid for MFF lentivirus packaging, MFF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to MFF/C2orf33 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $588.12
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP-SPh-099
Gene Name MFF
Accession Number NM_020194
Gene ID 56947
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1029 bp
Gene Alias C2orf33,EMPF2,GL004
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGTAAAGGAACAAGCAGTGACACATCACTAGGAAGGGTGAGCAGGGCAGCATTTCCTTCTCCCACTGCTGCTGAGATGGCAGAAATTAGTCGAATTCAGTACGAAATGGAATATACTGAAGGCATTAGTCAGCGAATGAGGGTCCCAGAAAAGTTAAAAGTAGCACCGCCAAACGCTGACCTGGAACAAGGATTCCAAGAAGGAGTTCCAAATGCTAGTGTGATAATGCAAGTTCCGGAGAGGATTGTTGTAGCAGGAAATAATGAAGATGTTTCATTTTCAAGACCAGCAGATCTTGACCTTATTCAGTCAACTCCCTTTAAACCCCTGGCACTGAAAACACCACCTCGTGTACTTACGCTGAGTGAAAGACCACTAGATTTTCTGGATTTAGAAAGACCTCCTACAACCCCTCAAAATGAAGAAATCCGAGCAGTTGGCAGACTAAAAAGAGAGCGGTCTATGAGTGAAAATGCTGTTCGCCAAAATGGACAGCTGGTCAGAAATGATTCTCTGTGGCACAGATCAGATTCTGCCCCAAGAAATAAAATTTCAAGGTTCCAGGCACCGATTTCTGCACCGGAGTACACTGTGACACCATCGCCACAACAGGCTCGGGTCTGTCCTCCCCATATGTTACCTGAAGATGGAGCTAATCTTTCCTCTGCTCGTGGCATTTTGTCGCTTATCCAGTCTTCTACTCGTAGGGCATACCAGCAGATCTTGGATGTGCTGGATGAAAATCGCAGACCTGTGTTGCGTGGTGGGTCTGCTGCCGCCACTTCTAATCCTCATCATGACAACGTCAGGTATGGCATTTCAAATATAGATACAACCATTGAAGGAACGTCAGATGACCTGACTGTTGTAGATGCAGCTTCACTAAGACGACAGATAATCAAACTAAATAGACGTCTACAACTTCTGGAAGAGGAGAACAAAGAACGTGCTAAAAGAGAAATGGTCATGTATTCAATTACTGTAGCTTTCTGGCTGCTTAATAGCTGGCTCTGGTTTCGCCGCTAG
ORF Protein Sequence MSKGTSSDTSLGRVSRAAFPSPTAAEMAEISRIQYEMEYTEGISQRMRVPEKLKVAPPNADLEQGFQEGVPNASVIMQVPERIVVAGNNEDVSFSRPADLDLIQSTPFKPLALKTPPRVLTLSERPLDFLDLERPPTTPQNEEIRAVGRLKRERSMSENAVRQNGQLVRNDSLWHRSDSAPRNKISRFQAPISAPEYTVTPSPQQARVCPPHMLPEDGANLSSARGILSLIQSSTRRAYQQILDVLDENRRPVLRGGSAAATSNPHHDNVRYGISNIDTTIEGTSDDLTVVDAASLRRQIIKLNRRLQLLEEENKERAKREMVMYSITVAFWLLNSWLWFRR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1171-Ab Anti-MFF monoclonal antibody
    Target Antigen GM-Tg-g-IP1171-Ag MFF protein
    ORF Viral Vector pGMLP003558 Human MFF Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-099 Human MFF Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-239 Human MFF Adenovirus plasmid
    ORF Viral Vector vGMLP003558 Human MFF Lentivirus particle
    ORF Viral Vector vGMLP-SPh-099 Human MFF Lentivirus particle
    ORF Viral Vector vGMAP-SPh-239 Human MFF Adenovirus particle


    Target information

    Target ID GM-IP1171
    Target Name MFF
    Gene ID 56947, 75734, 708489, 301563, 101087770, 477395, 506291, 100056853
    Gene Symbol and Synonyms 5230400G24Rik,C2H2orf33,C2orf33,EMPF2,GL004,MFF,RGD1310230
    Uniprot Accession Q9GZY8
    Uniprot Entry Name MFF_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000168958
    Target Classification Not Available

    This is a nuclear gene encoding a protein that functions in mitochondrial and peroxisomal fission. The encoded protein recruits dynamin-1-like protein (DNM1L) to mitochondria. There are multiple pseudogenes for this gene on chromosomes 1, 5, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.