Human TIMP4/TIMP-4 ORF/cDNA clone-Lentivirus plasmid (NM_003256)

Pre-made Human TIMP4/TIMP-4 Lentiviral expression plasmid for TIMP4 lentivirus packaging, TIMP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TIMP4/TIMP-4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000048 Human TIMP4 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000048
Gene Name TIMP4
Accession Number NM_003256
Gene ID 7079
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 675 bp
Gene Alias TIMP-4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCTGGGAGCCCTCGGCCCGCGCCAAGCTGGGTGCTGTTGCTGCGGCTGCTGGCGTTGCTGCGGCCCCCGGGGCTGGGTGAGGCATGCAGCTGCGCCCCGGCGCACCCTCAGCAGCACATCTGCCACTCGGCACTTGTGATTCGGGCCAAAATCTCCAGTGAGAAGGTAGTTCCGGCCAGTGCAGACCCTGCTGACACTGAAAAAATGCTCCGGTATGAAATCAAACAGATAAAGATGTTCAAAGGGTTTGAGAAAGTCAAGGATGTTCAGTATATCTATACGCCTTTTGACTCTTCCCTCTGTGGTGTGAAACTAGAAGCCAACAGCCAGAAGCAGTATCTCTTGACTGGTCAGGTCCTCAGTGATGGAAAAGTCTTCATCCATCTGTGCAACTACATCGAGCCCTGGGAGGACCTGTCCTTGGTGCAGAGGGAAAGTCTGAATCATCACTACCATCTGAACTGTGGCTGCCAAATCACCACCTGCTACACAGTACCCTGTACCATCTCGGCCCCTAACGAGTGCCTCTGGACAGACTGGCTGTTGGAACGAAAGCTCTATGGTTACCAGGCTCAGCATTATGTCTGTATGAAGCATGTTGACGGCACCTGCAGCTGGTACCGGGGCCACCTGCCTCTCAGGAAGGAGTTTGTTGACATCGTTCAGCCCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1340-Ab Anti-TIMP4/ TIMP-4 functional antibody
    Target Antigen GM-Tg-g-SE1340-Ag TIMP4 protein
    ORF Viral Vector pGMLP000048 Human TIMP4 Lentivirus plasmid
    ORF Viral Vector vGMLP000048 Human TIMP4 Lentivirus particle


    Target information

    Target ID GM-SE1340
    Target Name TIMP4
    Gene ID 7079, 110595, 100427947, 680130, 101094660, 100688494, 317694, 100051332
    Gene Symbol and Synonyms TIMP-4,TIMP4
    Uniprot Accession Q99727
    Uniprot Entry Name TIMP4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000157150
    Target Classification Not Available

    This gene belongs to the TIMP gene family. The proteins encoded by this gene family are inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix. The secreted, netrin domain-containing protein encoded by this gene is involved in regulation of platelet aggregation and recruitment and may play role in hormonal regulation and endometrial tissue remodeling. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.