Human EHF/ESE3/ ESE3B ORF/cDNA clone-Lentivirus plasmid (NM_012153)
Pre-made Human EHF/ESE3/ ESE3B Lentiviral expression plasmid for EHF lentivirus packaging, EHF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to EHF/ESE3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000091 | Human EHF Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000091 |
Gene Name | EHF |
Accession Number | NM_012153 |
Gene ID | 26298 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 903 bp |
Gene Alias | ESE3, ESE3B, ESEJ |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGATTCTGGAAGGAGGTGGTGTAATGAATCTCAACCCCGGCAACAACCTCCTTCACCAGCCGCCAGCCTGGACAGACAGCTACTCCACGTGCAATGTTTCCAGTGGGTTTTTTGGAGGCCAGTGGCATGAAATTCATCCTCAGTACTGGACCAAGTACCAGGTGTGGGAGTGGCTCCAGCACCTCCTGGACACCAACCAGCTGGATGCCAATTGTATCCCTTTCCAAGAGTTCGACATCAACGGCGAGCACCTCTGCAGCATGAGTTTGCAGGAGTTCACCCGGGCGGCAGGGACGGCGGGGCAGCTCCTCTACAGCAACTTGCAGCATCTGAAGTGGAACGGCCAGTGCAGTAGTGACCTGTTCCAGTCCACACACAATGTCATTGTCAAGACTGAACAAACTGAGCCTTCCATCATGAACACCTGGAAAGACGAGAACTATTTATATGACACCAACTATGGTAGCACAGTAGATTTGTTGGACAGCAAAACTTTCTGCCGGGCTCAGATCTCCATGACAACCACCAGTCACCTTCCTGTTGCAGAGTCACCTGATATGAAAAAGGAGCAAGACCCCCCTGCCAAGTGCCACACCAAAAAGCACAACCCGAGAGGGACTCACTTATGGGAATTCATCCGCGACATCCTCTTGAACCCAGACAAGAACCCAGGATTAATAAAATGGGAAGACCGATCTGAGGGCGTCTTCAGGTTCTTGAAATCAGAGGCAGTGGCTCAGCTATGGGGTAAAAAGAAGAACAACAGCAGCATGACCTATGAAAAGCTCAGCCGAGCTATGAGATATTACTACAAAAGAGAAATTCTGGAGCGTGTGGATGGACGAAGACTGGTATATAAATTTGGGAAGAATGCCCGAGGATGGAGAGAAAATGAAAACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1503-Ab | Anti-EHF/ ESE3/ ESE3B functional antibody |
Target Antigen | GM-Tg-g-SE1503-Ag | EHF protein |
ORF Viral Vector | pGMLP000091 | Human EHF Lentivirus plasmid |
ORF Viral Vector | vGMLP000091 | Human EHF Lentivirus particle |
Target information
Target ID | GM-SE1503 |
Target Name | EHF |
Gene ID | 26298, 13661, 717350, 295965, 101094540, 483428, 505422, 100059218 |
Gene Symbol and Synonyms | 9030625L19Rik,EHF,ESE3,ESE3B,ESEJ |
Uniprot Accession | Q9NZC4 |
Uniprot Entry Name | EHF_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000135373 |
Target Classification | Not Available |
This gene encodes a protein that belongs to an ETS transcription factor subfamily characterized by epithelial-specific expression (ESEs). The encoded protein acts as a transcriptional repressor and may be involved in epithelial differentiation and carcinogenesis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.