Human EHF/ESE3/ ESE3B ORF/cDNA clone-Lentivirus plasmid (NM_012153)

Pre-made Human EHF/ESE3/ ESE3B Lentiviral expression plasmid for EHF lentivirus packaging, EHF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to EHF/ESE3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000091 Human EHF Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000091
Gene Name EHF
Accession Number NM_012153
Gene ID 26298
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 903 bp
Gene Alias ESE3, ESE3B, ESEJ
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATTCTGGAAGGAGGTGGTGTAATGAATCTCAACCCCGGCAACAACCTCCTTCACCAGCCGCCAGCCTGGACAGACAGCTACTCCACGTGCAATGTTTCCAGTGGGTTTTTTGGAGGCCAGTGGCATGAAATTCATCCTCAGTACTGGACCAAGTACCAGGTGTGGGAGTGGCTCCAGCACCTCCTGGACACCAACCAGCTGGATGCCAATTGTATCCCTTTCCAAGAGTTCGACATCAACGGCGAGCACCTCTGCAGCATGAGTTTGCAGGAGTTCACCCGGGCGGCAGGGACGGCGGGGCAGCTCCTCTACAGCAACTTGCAGCATCTGAAGTGGAACGGCCAGTGCAGTAGTGACCTGTTCCAGTCCACACACAATGTCATTGTCAAGACTGAACAAACTGAGCCTTCCATCATGAACACCTGGAAAGACGAGAACTATTTATATGACACCAACTATGGTAGCACAGTAGATTTGTTGGACAGCAAAACTTTCTGCCGGGCTCAGATCTCCATGACAACCACCAGTCACCTTCCTGTTGCAGAGTCACCTGATATGAAAAAGGAGCAAGACCCCCCTGCCAAGTGCCACACCAAAAAGCACAACCCGAGAGGGACTCACTTATGGGAATTCATCCGCGACATCCTCTTGAACCCAGACAAGAACCCAGGATTAATAAAATGGGAAGACCGATCTGAGGGCGTCTTCAGGTTCTTGAAATCAGAGGCAGTGGCTCAGCTATGGGGTAAAAAGAAGAACAACAGCAGCATGACCTATGAAAAGCTCAGCCGAGCTATGAGATATTACTACAAAAGAGAAATTCTGGAGCGTGTGGATGGACGAAGACTGGTATATAAATTTGGGAAGAATGCCCGAGGATGGAGAGAAAATGAAAACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1503-Ab Anti-EHF/ ESE3/ ESE3B functional antibody
    Target Antigen GM-Tg-g-SE1503-Ag EHF protein
    ORF Viral Vector pGMLP000091 Human EHF Lentivirus plasmid
    ORF Viral Vector vGMLP000091 Human EHF Lentivirus particle


    Target information

    Target ID GM-SE1503
    Target Name EHF
    Gene ID 26298, 13661, 717350, 295965, 101094540, 483428, 505422, 100059218
    Gene Symbol and Synonyms 9030625L19Rik,EHF,ESE3,ESE3B,ESEJ
    Uniprot Accession Q9NZC4
    Uniprot Entry Name EHF_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Prostate Cancer
    Gene Ensembl ENSG00000135373
    Target Classification Not Available

    This gene encodes a protein that belongs to an ETS transcription factor subfamily characterized by epithelial-specific expression (ESEs). The encoded protein acts as a transcriptional repressor and may be involved in epithelial differentiation and carcinogenesis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.