Human BMP5 ORF/cDNA clone-Lentivirus plasmid (NM_021073)
Pre-made Human BMP5/ Lentiviral expression plasmid for BMP5 lentivirus packaging, BMP5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to BMP5/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000115 | Human BMP5 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000115 |
Gene Name | BMP5 |
Accession Number | NM_021073 |
Gene ID | 653 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1365 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCATCTGACTGTATTTTTACTTAAGGGTATTGTGGGTTTCCTCTGGAGCTGCTGGGTTCTAGTGGGTTATGCAAAAGGAGGTTTGGGAGACAATCATGTTCACTCCAGTTTTATTTATAGAAGACTACGGAACCACGAAAGACGGGAAATACAAAGGGAAATTCTCTCTATCTTGGGTTTGCCTCACAGACCCAGACCATTTTCACCTGGAAAACAAGCGTCCTCTGCACCTCTCTTTATGCTGGATCTCTACAATGCCATGACCAATGAAGAAAATCCTGAAGAGTCGGAGTACTCAGTAAGGGCATCCTTGGCAGAAGAGACCAGAGGGGCAAGAAAGGGATACCCAGCCTCTCCCAATGGGTATCCTCGTCGCATACAGTTATCTCGGACGACTCCTCTGACCACCCAGAGTCCTCCTCTAGCCAGCCTCCATGATACCAACTTTCTGAATGATGCTGACATGGTCATGAGCTTTGTCAACTTAGTTGAAAGAGACAAGGATTTTTCTCACCAGCGAAGGCATTACAAAGAATTTCGATTTGATCTTACCCAAATTCCTCATGGAGAGGCAGTGACAGCAGCTGAATTCCGGATATACAAGGACCGGAGCAACAACCGATTTGAAAATGAAACAATTAAGATTAGCATATATCAAATCATCAAGGAATACACAAATAGGGATGCAGATCTGTTCTTGTTAGACACAAGAAAGGCCCAAGCTTTAGATGTGGGTTGGCTTGTCTTTGATATCACTGTGACCAGCAATCATTGGGTGATTAATCCCCAGAATAATTTGGGCTTACAGCTCTGTGCAGAAACAGGGGATGGACGCAGTATCAACGTAAAATCTGCTGGTCTTGTGGGAAGACAGGGACCTCAGTCAAAACAACCATTCATGGTGGCCTTCTTCAAGGCGAGTGAGGTACTTCTTCGATCCGTGAGAGCAGCCAACAAACGAAAAAATCAAAACCGCAATAAATCCAGCTCTCATCAGGACTCCTCCAGAATGTCCAGTGTTGGAGATTATAACACAAGTGAGCAAAAACAAGCCTGTAAGAAGCACGAACTCTATGTGAGCTTCCGGGATCTGGGATGGCAGGACTGGATTATAGCACCAGAAGGATACGCTGCATTTTATTGTGATGGAGAATGTTCTTTTCCACTTAACGCCCATATGAATGCCACCAACCACGCTATAGTTCAGACTCTGGTTCATCTGATGTTTCCTGACCACGTACCAAAGCCTTGTTGTGCTCCAACCAAATTAAATGCCATCTCTGTTCTGTACTTTGATGACAGCTCCAATGTCATTTTGAAAAAATATAGAAATATGGTAGTACGCTCATGTGGCTGCCACTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0686-Ab | Anti-BMP5 functional antibody |
Target Antigen | GM-Tg-g-SE0686-Ag | BMP5 protein |
Cytokine | cks-Tg-g-GM-SE0686 | bone morphogenetic protein 5 (BMP5) protein & antibody |
ORF Viral Vector | pGMLP000115 | Human BMP5 Lentivirus plasmid |
ORF Viral Vector | vGMLP000115 | Human BMP5 Lentivirus particle |
Target information
Target ID | GM-SE0686 |
Target Name | BMP5 |
Gene ID | 653, 12160, 711989, 315824, 101097318, 474944, 507682, 100056806 |
Gene Symbol and Synonyms | BMP5,se |
Uniprot Accession | P22003 |
Uniprot Entry Name | BMP5_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000112175 |
Target Classification | Not Available |
This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer, which plays a role in bone and cartilage development. Polymorphisms in this gene may be associated with osteoarthritis in human patients. This gene is differentially regulated in multiple human cancers. This gene encodes distinct protein isoforms that may be similarly proteolytically processed. [provided by RefSeq, Jul 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.