Human GJB3/CX31/DFNA2 ORF/cDNA clone-Lentivirus plasmid (NM_024009)
Cat. No.: pGMLP000126
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human GJB3/CX31/DFNA2 Lentiviral expression plasmid for GJB3 lentivirus packaging, GJB3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
Cx31/GJB3/CX31 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000126 |
Gene Name | GJB3 |
Accession Number | NM_024009 |
Gene ID | 2707 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 813 bp |
Gene Alias | CX31,DFNA2,DFNA2B,EKV,EKVP1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGACTGGAAGACACTCCAGGCCCTACTGAGCGGTGTGAACAAGTACTCCACAGCGTTCGGGCGCATCTGGCTGTCCGTGGTGTTCGTCTTCCGGGTGCTGGTATACGTGGTGGCTGCAGAGCGCGTGTGGGGGGATGAGCAGAAGGACTTTGACTGCAACACCAAGCAGCCCGGCTGCACCAACGTCTGCTACGACAACTACTTCCCCATCTCCAACATCCGCCTCTGGGCCCTGCAGCTCATCTTCGTCACATGCCCCTCGCTGCTGGTCATCCTGCACGTGGCCTACCGTGAGGAGCGGGAGCGCCGGCACCGCCAGAAACACGGGGACCAGTGCGCCAAGCTGTACGACAACGCAGGCAAGAAGCACGGAGGCCTGTGGTGGACCTACCTGTTCAGCCTCATCTTCAAGCTCATCATTGAGTTCCTCTTCCTCTACCTGCTGCACACTCTCTGGCATGGCTTCAATATGCCGCGCCTGGTGCAGTGTGCCAACGTGGCCCCCTGCCCCAACATCGTGGACTGCTACATTGCCCGACCTACCGAGAAGAAAATCTTCACCTACTTCATGGTGGGCGCCTCCGCCGTCTGCATCGTACTCACCATCTGTGAGCTCTGCTACCTCATCTGCCACAGGGTCCTGCGAGGCCTGCACAAGGACAAGCCTCGAGGGGGTTGCAGCCCCTCGTCCTCCGCCAGCCGAGCTTCCACCTGCCGCTGCCACCACAAGCTGGTGGAGGCTGGGGAGGTGGATCCAGACCCAGGCAATAACAAGCTGCAGGCTTCAGCACCCAACCTGACCCCCATCTGA |
ORF Protein Sequence | MDWKTLQALLSGVNKYSTAFGRIWLSVVFVFRVLVYVVAAERVWGDEQKDFDCNTKQPGCTNVCYDNYFPISNIRLWALQLIFVTCPSLLVILHVAYREERERRHRQKHGDQCAKLYDNAGKKHGGLWWTYLFSLIFKLIIEFLFLYLLHTLWHGFNMPRLVQCANVAPCPNIVDCYIARPTEKKIFTYFMVGASAVCIVLTICELCYLICHRVLRGLHKDKPRGGCSPSSSASRASTCRCHHKLVEAGEVDPDPGNNKLQASAPNLTPI |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0171-Ab | Anti-Cx31 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0171-Ag | Cx31/GJB3 protein |
ORF Viral Vector | pGMLP000126 | Human GJB3 Lentivirus plasmid |
ORF Viral Vector | vGMLP000126 | Human GJB3 Lentivirus particle |
Target information
Target ID | GM-IP0171 |
Target Name | Cx31 |
Gene ID | 2707, 14620, 710834, 29585, 101083782, 482486, 539935, 100055573 |
Gene Symbol and Synonyms | Cnx31,CX31,Cxnc,D4Wsu144e,DFNA2,DFNA2B,EKV,EKVP1,Gjb-3,GJB3 |
Uniprot Accession | O75712 |
Uniprot Entry Name | CXB3_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000188910 |
Target Classification | Not Available |
This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene can cause non-syndromic deafness or erythrokeratodermia variabilis, a skin disorder. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.