Human KLK4/AI2A1/ARM1 ORF/cDNA clone-Lentivirus plasmid (NM_004917)

Cat. No.: pGMLP000166
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KLK4/AI2A1/ARM1 Lentiviral expression plasmid for KLK4 lentivirus packaging, KLK4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to KLK4/AI2A1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $491.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000166
Gene Name KLK4
Accession Number NM_004917
Gene ID 9622
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 765 bp
Gene Alias AI2A1,ARM1,EMSP,EMSP1,kallikrein,KLK-L1,PRSS17,PSTS
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCACAGCAGGAAATCCCTGGGGCTGGTTCCTGGGGTACCTCATCCTTGGTGTCGCAGGATCGCTCGTCTCTGGTAGCTGCAGCCAAATCATAAACGGCGAGGACTGCAGCCCGCACTCGCAGCCCTGGCAGGCGGCACTGGTCATGGAAAACGAATTGTTCTGCTCGGGCGTCCTGGTGCATCCGCAGTGGGTGCTGTCAGCCGCACACTGTTTCCAGAACTCCTACACCATCGGGCTGGGCCTGCACAGTCTTGAGGCCGACCAAGAGCCAGGGAGCCAGATGGTGGAGGCCAGCCTCTCCGTACGGCACCCAGAGTACAACAGACCCTTGCTCGCTAACGACCTCATGCTCATCAAGTTGGACGAATCCGTGTCCGAGTCTGACACCATCCGGAGCATCAGCATTGCTTCGCAGTGCCCTACCGCGGGGAACTCTTGCCTCGTTTCTGGCTGGGGTCTGCTGGCGAACGGCAGAATGCCTACCGTGCTGCAGTGCGTGAACGTGTCGGTGGTGTCTGAGGAGGTCTGCAGTAAGCTCTATGACCCGCTGTACCACCCCAGCATGTTCTGCGCCGGCGGAGGGCAAGACCAGAAGGACTCCTGCAACGGTGACTCTGGGGGGCCCCTGATCTGCAACGGGTACTTGCAGGGCCTTGTGTCTTTCGGAAAAGCCCCGTGTGGCCAAGTTGGCGTGCCAGGTGTCTACACCAACCTCTGCAAATTCACTGAGTGGATAGAGAAAACCGTCCAGGCCAGTTAA
ORF Protein Sequence MATAGNPWGWFLGYLILGVAGSLVSGSCSQIINGEDCSPHSQPWQAALVMENELFCSGVLVHPQWVLSAAHCFQNSYTIGLGLHSLEADQEPGSQMVEASLSVRHPEYNRPLLANDLMLIKLDESVSESDTIRSISIASQCPTAGNSCLVSGWGLLANGRMPTVLQCVNVSVVSEEVCSKLYDPLYHPSMFCAGGGQDQKDSCNGDSGGPLICNGYLQGLVSFGKAPCGQVGVPGVYTNLCKFTEWIEKTVQAS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T79400-Ab Anti-KLK4/ AI2A1/ ARM1 functional antibody
    Target Antigen GM-Tg-g-T79400-Ag KLK4 protein
    ORF Viral Vector pGMLP000166 Human KLK4 Lentivirus plasmid
    ORF Viral Vector vGMLP000166 Human KLK4 Lentivirus particle


    Target information

    Target ID GM-T79400
    Target Name KLK4
    Gene ID 9622, 56640, 719422, 408210, 101089560, 484354, 507800
    Gene Symbol and Synonyms AI2A1,ARM1,EMSP,EMSP1,ESMP1,kallikrein,KLK-L1,KLK4,Klnb1,PRSS17,PSTS
    Uniprot Accession Q9Y5K2
    Uniprot Entry Name KLK4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000167749
    Target Classification Tumor-associated antigen (TAA)

    Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In some tissues its expression is hormonally regulated. The expression pattern of a similar mouse protein in murine developing teeth supports a role for the protein in the degradation of enamel proteins. Several transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Dec 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.