Human SMAF1 ORF/cDNA clone-Lentivirus plasmid (DQ891502.2)

Cat. No.: pGMLP000204
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SMAF1/ Lentiviral expression plasmid for SMAF1 lentivirus packaging, SMAF1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to ADIG/SMAF1/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000204
Gene Name SMAF1
Accession Number DQ891502.2
Gene ID 149685
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 357 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACTCCAGTGTGTGCTTGGATTGGGAGCCCTGGAGCAAAGGCCCAGCTGAGTTTTGCTGGAAGGGGACACTCCACGGCCAAGAGAAGGAGAGGCCCTGCTGGTGAGCCTGCTGTGCCAGGTGAGGCACTTCCAGGGGCCAGGGGGAGCCTCAAGGCCCACCCAAAGCCTTGGGCAGCTGCTATGTGGGCAAGAGGCTGCCTCCACCATATTAGAGTTTGGTTTTCCTGGAGTCAGCAGGGCAGTGGCAATGGCAGAAGTGGATGGGAGAGACTTGCCAGGGAGGCAAGAGGACTTTGGCAACTGTGGTGCCTCCCTGGAACCCCCAACTCATCTCCTCTTCAGACCGACATGTAG
ORF Protein Sequence MTPVCAWIGSPGAKAQLSFAGRGHSTAKRRRGPAGEPAVPGEALPGARGSLKAHPKPWAAAMWARGCLHHIRVWFSWSQQGSGNGRSGWERLAREARGLWQLWCLPGTPNSSPLQTDM

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0014-Ab Anti-ADIG/ SMAF1 functional antibody
    Target Antigen GM-Tg-g-SE0014-Ag ADIG protein
    ORF Viral Vector pGMLP000204 Human SMAF1 Lentivirus plasmid
    ORF Viral Vector vGMLP000204 Human SMAF1 Lentivirus particle


    Target information

    Target ID GM-SE0014
    Target Name ADIG
    Gene ID 149685, 246747, 698691, 100361007, 101097136, 100685988, 510677, 100630181
    Gene Symbol and Synonyms ADIG,SMAF-1,SMAF1
    Uniprot Accession Q0VDE8
    Uniprot Entry Name ADIG_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000182035
    Target Classification Not Available

    ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation (Kim et al., 2005 [PubMed 15567149]; Hong et al., 2005 [PubMed 16132694]).[supplied by OMIM, Mar 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.